Product Description

Integrin α5 (CD49e) Recombinant Protein

Catalogue Number: NCP0244-500, NCP0244-1000

Sizes: 500ug, 1mg

Swiss-Prot: P08648

Host: E.coli

Tag: His-tag

AA Sequence: CCTATTAACCCGAAAGGCCTGGAACTGGATCCGGAAGGTAGTCTGCATCATCAGCAGAAACGTGAAGCACCGAGTCGCAGTAGTGCCAGTAGCGGCCCGCAGATTCTGAAATGCCCGGAAGCCGAATGCTTCCGCCTGCGCTGTGAACTGGGCCCGCTGCATCAGCAGGAAAGCCAGAGCCTGCAGCTGCACTTCCGTGTGTGGGCAAAAACCTTCCTGCAGCGTGAACATCAGCCGTTCAGCCTGCAGTGCGAAGCAGTGTATAAAGCACTGAAAATGCCGTATCGTATTCTGCCGCGCCAGCTGCCGCAGAAAGAACGCCAGGTTGCAACCGCAGTGCAGTGGACCAAAGCAGAAGGCAGCTAT

Restriction Sites: NdeI-XhoI

Background: Integrins are α/β heterodimeric cell surface receptors that play a pivotal role in cell adhesion and migration, as well as in growth and survival. The integrin family contains at least 18 α and 8 β subunits that form 24 known integrins with distinct tissue distribution and overlapping ligand specificities. Integrins not only transmit signals to cells in response to the extracellular environment (outside-in signaling), but also sense intracellular cues to alter their interaction with the extracellular environment (inside-out signaling). Integrin α5/β1 is involved in multiple biological processes including embryonic development, angiogenesis and tumor metastasis. By interaction with its fibronectin ligand, α5/β1 transduces signals that regulate cell adhesion, migration, matrix assembly and cytoskeletal organization.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~16kDa

Notes: For research use only, not for use in diagnostic procedure.