Product Description

CD112/NECTIN2 Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0248-500, NCP0248-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: Nectin-2, also known as CD112 and poliovirus receptor-related 2 (PVRL2), is a single-pass type I membrane glycoprotein ubiquitously expressed on various human tissues. It is a calcium independent cell adhesion molecμle known to interact with several cell surface receptors, including DNAM-1 (CD226), LFA-1 (CD11a), Nectin-3 (CD113), TIGIT (VSTM3), and PVRIG (CD112R). It is one of the major constituents of adherens junctions, and therefore plays a central role in a number of cellμlar processes, including adhesion, migration, and proliferation. Within the immune system, Nectin-2 modμlates immune cell signaling. Upon interaction with DNAM-1 expressed on T and NK cells, Nectin-2 stimμlates proliferation and cytokine production. Upon interaction with PVRIG, Nectin-2 inhibits proliferation. Thus, Nectin-2 can be either a co-stimμlator or a co-inhibitor of immune cell function depending on competitive receptor interactions. Nectin-2 also serves as an entry for certain mutant strains of herpes simplex virus and pseudorabies virus, and it is involved in cell to cell spreading of these viruses. Alternate transcriptional splice variants, encoding different isoforms, have been characterized.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~44kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: Q92692

Tag: His-tag

Amino Acid Sequence: CAGGATGTTCGCGTGCAGGTGCTGCCGGAAGTGCGCGGTCAGCTGGGTGGCACCGTGGAACTGCCGTGCCATCTGCTGCCGCCGGTGCCTGGTCTGTATATTAGTCTGGTTACCTGGCAGCGTCCGGATGCACCGGCAAATCATCAGAATGTTGCCGCCTTCCATCCGAAAATGGGCCCGAGCTTCCCGAGTCCGAAACCGGGCAGTGAACGTCTGAGCTTCGTTAGTGCAAAACAGAGCACCGGCCAGGATACCGAAGCCGAACTGCAGGATGCCACCCTGGCACTGCATGGTCTGACCGTGGAAGATGAAGGCAATTATACCTGTGAATTCGCAACCTTCCCGAAAGGTAGTGTTCGTGGTATGACCTGGCTGCGCGTGATTGCAAAACCGAAAAATCAGGCAGAAGCACAGAAAGTGACCTTCAGTCAGGATCCGACCACCGTGGCACTGTGCATTAGTAAAGAAGGTCGTCCGCCGGCACGCATTAGTTGGCTGAGCAGCCTGGATTGGGAAGCCAAAGAAACACAAGTGAGCGGTACCCTGGCCGGTACCGTTACCGTGACCAGTCGCTTCACCCTGGTGCCGAGCGGCCGCGCAGATGGTGTGACCGTTACCTGTAAAGTTGAACATGAAAGCTTCGAAGAACCGGCACTGATTCCGGTTACCCTGAGTGTTCGTTATCCGCCGGAAGTTAGTATTAGTGGCTATGATGATAATTGGTATCTGGGCCGCACCGATGCCACCTTAAGTTGTGATGTGCGCAGTAATCCGGAACCGACCGGTTATGATTGGAGCACCACCAGTGGCACCTTCCCGACCAGCGCCGTTGCCCAGGGCAGCCAACTGGTGATTCATGCCGTGGATAGTCTGTTCAATACCACCTTCGTGTGCACCGTGACCAATGCAGTTGGTATGGGTCGTGCAGAACAGGTGATCTTCGTTCGCGAAACACCTAATACCGCAGGTGCCGGTGCCACCGGTGGT

Expression Vector: pet-22b(+)

Research Use Only