Product Description

CD113/NECTIN3 Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0249-500, NCP0249-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: Nectin is a Ca2+-independent homophilic cell adhesion molecμle that belongs to the immunoglobμlin superfamily. Human Nectin is identical to the poliovirus receptor-related protein (PRR) and is identified to be the alphaherpesvirus entry mediator. Nectin constitutes a family consisting of at least Nectin 1, 2 and 3. Nectin 2 and 3 are ubiquitously expressed, whereas Nectin 1 is abundantly expressed in brain. Nectin 3, also designated as PRR3, has three splicing variants: Nectin 3α, 3β and 3γ. Nectin 3 is a transmembrane protein whose extracellμlar region contains three Ig-like domains. Nectin 3α and 3β, but not Nectin 3γ, have a C-terminal conserved motif (E/A-X-Y-V). This motif interacts with the PDZ domain of the F-Actin-binding protein, afadin, through which it is linked to the Actin cytoskeleton. Nectin 3α co-localizes with Nectin 2 at cadherin-based adheren junctions and interacts with afadin.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~38kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: Q9NQS3

Tag: His-tag

Amino Acid Sequence: GGTCCTATTATTGTTGAACCGCATGTTACCGCCGTGTGGGGTAAAAATGTTAGTCTGAAATGCCTGATTGAAGTGAATGAAACCATTACCCAGATTAGTTGGGAAAAAATTCATGGCAAAAGTAGCCAGACCGTTGCCGTTCATCATCCGCAGTATGGCTTCAGTGTTCAGGGTGAATATCAGGGTCGTGTGCTGTTCAAAAATTATAGCCTGAATGATGCAACCATTACCCTGCATAATATTGGCTTCAGCGATAGTGGCAAATATATCTGTAAAGCCGTTACCTTCCCGCTGGGTAATGCACAGAGCAGCACCACCGTGACCGTTCTGGTTGAACCGACCGTTAGCCTGATTAAAGGCCCGGATAGTCTGATTGATGGTGGCAATGAAACCGTTGCAGCCATCTGTATTGCCGCCACCGGTAAACCGGTTGCACATATTGATTGGGAAGGCGATCTGGGCGAAATGGAAAGCACCACCACCAGCTTCCCGAATGAAACCGCAACCATTATTAGCCAGTATAAACTGTTCCCGACCCGCTTCGCACGTGGTCGTCGTATTACCTGTGTTGTTAAACATCCGGCCCTGGAAAAAGATATTCGTTATAGCTTCATTCTGGATATTCAGTATGCCCCGGAAGTTAGTGTTACCGGCTATGATGGTAATTGGTTCGTGGGTCGTAAAGGTGTTAATCTGAAATGCAATGCAGATGCCAATCCGCCGCCGTTCAAAAGCGTGTGGAGTCGTCTGGATGGCCAGTGGCCGGATGGTCTGCTGGCCAGCGATAATACCCTGCACTTCGTTCATCCGCTGACCTTCAATTATAGTGGCGTGTATATCTGTAAGGTGACCAATAGTCTGGGCCAGCGTAGCGATCAGAAAGTTATCTATATTAGTGATCCGCCGACCACCACCACCCTGCAGCCGACAATTCAGTGGCATCCGAGTACCGCAGATATTGAAGATCTGGCAACCGAACCGAAAAAACTGCCGTTCCCGCTGAGCACCCTGGCCACCATTAAAGATGATACCATTGCAACC

Expression Vector: pet-22b(+)

Research Use Only