BioWorld
CD113/NECTIN3 Recombinant Protein - NCP0249
CD113/NECTIN3 Recombinant Protein - NCP0249
Couldn't load pickup availability
CD113/NECTIN3 Recombinant Protein
Catalogue Number: NCP0249-500, NCP0249-1000
Sizes: 500ug, 1mg
Swiss-Prot: Q9NQS3
Host: E.coli
Tag: His-tag
AA Sequence: GGTCCTATTATTGTTGAACCGCATGTTACCGCCGTGTGGGGTAAAAATGTTAGTCTGAAATGCCTGATTGAAGTGAATGAAACCATTACCCAGATTAGTTGGGAAAAAATTCATGGCAAAAGTAGCCAGACCGTTGCCGTTCATCATCCGCAGTATGGCTTCAGTGTTCAGGGTGAATATCAGGGTCGTGTGCTGTTCAAAAATTATAGCCTGAATGATGCAACCATTACCCTGCATAATATTGGCTTCAGCGATAGTGGCAAATATATCTGTAAAGCCGTTACCTTCCCGCTGGGTAATGCACAGAGCAGCACCACCGTGACCGTTCTGGTTGAACCGACCGTTAGCCTGATTAAAGGCCCGGATAGTCTGATTGATGGTGGCAATGAAACCGTTGCAGCCATCTGTATTGCCGCCACCGGTAAACCGGTTGCACATATTGATTGGGAAGGCGATCTGGGCGAAATGGAAAGCACCACCACCAGCTTCCCGAATGAAACCGCAACCATTATTAGCCAGTATAAACTGTTCCCGACCCGCTTCGCACGTGGTCGTCGTATTACCTGTGTTGTTAAACATCCGGCCCTGGAAAAAGATATTCGTTATAGCTTCATTCTGGATATTCAGTATGCCCCGGAAGTTAGTGTTACCGGCTATGATGGTAATTGGTTCGTGGGTCGTAAAGGTGTTAATCTGAAATGCAATGCAGATGCCAATCCGCCGCCGTTCAAAAGCGTGTGGAGTCGTCTGGATGGCCAGTGGCCGGATGGTCTGCTGGCCAGCGATAATACCCTGCACTTCGTTCATCCGCTGACCTTCAATTATAGTGGCGTGTATATCTGTAAGGTGACCAATAGTCTGGGCCAGCGTAGCGATCAGAAAGTTATCTATATTAGTGATCCGCCGACCACCACCACCCTGCAGCCGACAATTCAGTGGCATCCGAGTACCGCAGATATTGAAGATCTGGCAACCGAACCGAAAAAACTGCCGTTCCCGCTGAGCACCCTGGCCACCATTAAAGATGATACCATTGCAACC
Restriction Sites: NdeI-XhoI
Background: Nectin is a Ca2+-independent homophilic cell adhesion molecule that belongs to the immunoglobulin superfamily. Human Nectin is identical to the poliovirus receptor-related protein (PRR) and is identified to be the alphaherpesvirus entry mediator. Nectin constitutes a family consisting of at least Nectin 1, 2 and 3. Nectin 2 and 3 are ubiquitously expressed, whereas Nectin 1 is abundantly expressed in brain. Nectin 3, also designated as PRR3, has three splicing variants: Nectin 3α, 3β and 3γ. Nectin 3 is a transmembrane protein whose extracellular region contains three Ig-like domains. Nectin 3α and 3β, but not Nectin 3γ, have a C-terminal conserved motif (E/A-X-Y-V). This motif interacts with the PDZ domain of the F-Actin-binding protein, afadin, through which it is linked to the Actin cytoskeleton. Nectin 3α co-localizes with Nectin 2 at cadherin-based adheren junctions and interacts with afadin.
Soluble: PBS, 4M Urea, PH7.4
Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).
Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Expression Vector: pet-22b(+)
BioWorld Molecular Weight: ~38kDa
Notes: For research use only, not for use in diagnostic procedure.