Product Description

CD119 Recombinant Protein

Catalogue Number: NCP0255-500, NCP0255-1000

Sizes: 500ug, 1mg

Swiss-Prot: P15260

Host: E.coli

Tag: His-tag

AA Sequence: GAAATGGGTACCGCCGATCTGGGTCCGAGCAGTGTGCCGACCCCGACCAATGTGACCATTGAAAGCTATAATATGAACCCGATTGTGTATTGGGAATATCAGATTATGCCGCAGGTTCCGGTGTTCACCGTGGAAGTGAAAAATTATGGTGTGAAAAATAGCGAATGGATTGATGCATGCATTAATATTAGCCATCATTATTGTAACATCAGCGATCATGTTGGCGATCCGAGCAATAGCCTGTGGGTGCGTGTGAAAGCCCGCGTTGGCCAGAAAGAAAGCGCATACGCTAAAAGCGAAGAATTCGCAGTGTGTCGCGATGGCAAAATTGGCCCGCCGAAACTGGATATTCGCAAAGAAGAAAAACAGATTATGATCGATATCTTCCATCCGAGTGTGTTCGTGAATGGTGATGAACAGGAAGTTGATTATGATCCGGAAACCACCTGTTATATTCGCGTGTATAATGTGTATGTTCGCATGAATGGTAGCGAAATTCAGTATAAAATCCTGACCCAGAAAGAAGATGATTGTGATGAAATTCAGTGTCAGCTGGCAATTCCGGTGAGTAGTCTGAATAGTCAGTATTGTGTGAGCGCAGAAGGCGTTCTGCATGTGTGGGGTGTGACCACCGAAAAAAGTAAAGAAGTGTGTATTACCATCTTCAATAGTAGCATTAAGGGT

Restriction Sites: NdeI-XhoI

Background: IFN-γ plays key roles in both the innate and adaptive immune response. IFN-γ activates the cytotoxic activity of innate immune cells, such as macrophages and NK cells. IFN-γ production by NK cells and antigen presenting cells (APCs) promotes cell-mediated adaptive immunity by inducing IFN-γ production by T lymphocytes, increasing class I and class II MHC expression, and enhancing peptide antigen presentation. The anti-viral activity of IFN-γ is due to its induction of PKR and other regulatory proteins. Binding of IFN-γ to the IFNGR1/IFNGR2 complex promotes dimerization of the receptor complexes to form the (IFNGR1/IFNGR2)2 -IFN-γ dimer. Binding induces a conformational change in receptor intracellular domains and signaling involves Jak1, Jak2, and Stat1. The critical role of IFN-γ in amplification of immune surveillance and function is supported by increased susceptibility to pathogen infection by IFN-γ or IFNGR knockout mice and in humans with inactivating mutations in IFNGR1 or IFNGR2. IFN-γ also appears to have a role in atherosclerosis.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~30kDa

Notes: For research use only, not for use in diagnostic procedure.