Product Description

CD129/IL9R Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0258-500, NCP0258-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: Interleukin-9 (IL-9) functions to support the growth of helper T cells, megakaryoblastic leukemia cells, fetal thymocytes, erythroid and myeloid precursors and mast cells. The murine IL-9 receptor has been identified as a protein expressed on a T cell clone. Both the murine and human IL-9 receptor cDNAs have been isolated by expression cloning from the murine T cell clone TS1 and the human megakaryoblastic leukemia cell line MO7E, respectively. In addition, the cloning and analysis of the complete human IL-9 receptor genomic DNA has been reported. In this latter study, the IL-9R gene was shown to consist of 10 exons expressed over approximately 13.7 kb of DNA.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~30kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: Q01113

Tag: His-tag

Amino Acid Sequence: AGTGTGACCGGTGAAGGTCAGGGTCCGCGTAGCCGTACCTTCACCTGTCTGACCAATAATATTCTGCGCATTGATTGCCATTGGAGCGCCCCGGAACTGGGTCAGGGTAGCAGTCCGTGGCTGCTGTTCACCAGCAATCAGGCCCCGGGTGGTACCCATAAATGCATTCTGCGTGGCAGCGAATGCACCGTTGTGCTGCCGCCGGAAGCCGTGCTGGTTCCGAGTGATAACTTCACCATTACCTTCCATCATTGCATGAGTGGTCGTGAACAGGTTAGTCTGGTTGATCCGGAATATCTGCCGCGTCGTCATGTTAAACTGGATCCGCCGAGTGATCTGCAGAGCAATATTAGTAGCGGCCATTGCATTCTGACCTGGAGCATTAGCCCGGCCCTGGAACCGATGACCACCCTGCTGAGTTATGAACTGGCCTTCAAAAAACAGGAAGAAGCCTGGGAACAGGCACAGCATCGTGATCATATTGTTGGTGTGACCTGGCTGATTCTGGAAGCCTTCGAACTGGATCCGGGCTTCATTCATGAAGCCCGTCTGCGCGTTCAGATGGCAACCCTGGAAGATGATGTTGTGGAAGAAGAACGTTATACCGGCCAGTGGAGTGAATGGAGCCAGCCGGTGTGCTTCCAGGCACCGCAGCGTCAGGGCCCGCTGATTCCGCCTTGGGGTTGGCCG

Expression Vector: pet-22b(+)

Research Use Only