Bioworld
CD132 Recombinant Protein - NCP0260
CD132 Recombinant Protein - NCP0260
Couldn't load pickup availability
CD132 Recombinant Protein
Sizes: 500μg, 1mg
Catalogue Numbers: NCP0260-500, NCP0260-1000
Lead times: 1-2 weeks, if manufacturer has product in stock
Manufacturer/Ship Location: China
Background: The IL-2 receptor is a mμlticomponent complex consisting of three subunits, a, b and g, each of which is required for high affinity binding of IL-2. The a chain functions primarily in binding IL-2, whereas the b and g chains contribute to IL-2 binding and are essential to IL-2-induced activation of signaling pathways leading to T cell growth. Both IL-4R and IL-7R were initially described as single chain high affinity ligand binding cytokine receptors. However, it is now well established that the IL-2R g chain functions as a second subunit of the high affinity IL-4R and IL-7R receptors. Consequently, the originally described subunits of these latter receptors are now referred
to as IL-4Ra and IL-7Ra respectively, while the common subunit is referred to as gc. Although the common g chain enhances ligand binding in these three cytokine receptors, it has no capacity to bind these ligands on its own.There is evidence that the gc chain is also a subunit of IL-13R.
Category: Protein
Host: E. coli
Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).
Molecular Weight: ~30kDa
Solubility: PBS, 4M Urea, PH7.4
Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Restriction Sites: NdeI-XhoI
SwissProt: P31785
Tag: His-tag
Amino Acid Sequence: CTGAATACCACCATTCTGACCCCGAATGGTAATGAAGATACCACCGCCGACTTCTTCCTGACCACCATGCCGACCGATAGCCTGAGCGTTAGCACCCTGCCGCTGCCGGAAGTTCAGTGCTTCGTGTTCAATGTGGAATATATGAATTGCACCTGGAATAGTAGCAGCGAACCGCAGCCGACCAATCTGACCCTGCATTATTGGTATAAAAATAGTGATAACGACAAGGTTCAGAAATGCAGCCATTATCTGTTCAGCGAAGAAATTACCAGCGGTTGCCAGCTGCAGAAAAAAGAAATTCATCTGTATCAGACCTTCGTGGTGCAGCTGCAGGATCCGCGTGAACCGCGTCGCCAGGCCACCCAAATGCTGAAACTGCAGAATCTGGTGATTCCGTGGGCACCGGAAAATCTGACCTTACATAAACTGAGTGAAAGCCAGCTGGAACTGAATTGGAATAATCGCTTCCTGAATCATTGCCTGGAACATCTGGTTCAGTATCGTACCGATTGGGATCATAGTTGGACCGAACAGAGCGTTGATTATCGCCATAAATTCAGTCTGCCGAGTGTTGATGGTCAGAAACGCTATACCTTCCGTGTGCGCAGTCGCTTCAATCCGCTGTGCGGTAGCGCACAGCATTGGAGTGAATGGAGCCATCCGATTCATTGGGGTAGTAATACCAGCAAAGAAAATCCGTTCCTGTTCGCCCTGGAAGCC
Expression Vector: pet-22b(+)
Research Use Only
