Product Description

CD136/RON Recombinant Protein

Catalogue Number: NCP0175-500, NCP0175-1000

Sizes: 500ug, 1mg

Swiss-Prot: Q04912

Host: E.coli

Tag: His-tag

AA Sequence: GCTAGCTTCAGCGATAGTGAAGATGAAAGTTGTGTTCCGCTGCTGCGCAAAGAAAGTATTCAGCTGCGTGATCTGGATAGCGCACTGCTGGCCGAAGTGAAAGATGTTCTGATTCCGCATGAACGTGTGGTTACCCATAGTGATCGCGTGATTGGCAAAGGTCACTTCGGTGTGGTGTATCATGGTGAATATATTGATCAGGCACAGAATCGCATTCAGTGTGCCATTAAAAGCCTGAGTCGCATTACCGAAATGCAGCAGGTTGAAGCATTCCTGCGCGAAGGTCTGCTGATGCGCGGTCTGAATCATCCGAATGTGCTGGCCCTGATTGGTATTATGCTGCCGCCGGAAGGCCTGCCGCATGTGCTGCTGCCGTATATGTGCCATGGCGATCTGCTGCAGTTCATTCGTAGCCCGCAGCGTAATCCGACCGTGAAAGATCTGATTAGCTTCGGTCTGCAGGTTGCCCGTGGCATGGAATATCTGGCCGAACAGAAATTCGTGCATCGTGATCTGGCCGCACGCAATTGCATGCTGGATGAAAGCTTCACCGTGAAAGTTGCCGACTTCGGCCTGGCACGCGATATTCTGGATCGTGAATATTATAGTGTGCAGCAGCATCGTCATGCCCGCCTGCCGGTGAAATGGATGGCCCTGGAAAGTCTGCAGACCTATCGCTTCACCACCAAAAGTGATGTGTGGAGCTTCGGCGTGCTGCTGTGGGAACTGCTGACCCGCGGCGCCCCTCCTTATCGCCATATTGATCCGTTCGATCTGACCCACTTCCTGGCCCAGGGTCGCCGCCTGCCTCAGCCTGAATATTGTCCGGATAGTCTGTATCAGGTTATGCAGCAGTGCTGGGAAGCAGATCCGGCCGTTCGCCCG

Restriction Sites: NdeI-XhoI

Background: Ron is a member of the Met protooncogene family of receptor tyrosine kinases, which also includes Stk, c-Met, and c-Sea. The functional Ron is a heterodimer composed of a 40 kDa α chain and a 150 kDa β chain. Ron is initially synthesized in the cells as a single-chain, pro-Ron precursor that is cleaved into the two active chains. The α chain is completely extracellular, whereas the β chain traverses the cell membrane and contains the intracellular tyrosine kinase and regulatory elements. Ron mediates multiple signaling cascades that involve cell motility, adhesion, proliferation, and apoptosis. The signaling pathways activated downstream of Ron include the ras/mitogen-activated protein kinase (MAPK), phosphatidyl inositol-3 kinase (PI3K)/Akt, and focal adhesion kinase (FAK) pathways. Ron activation can also significantly increase c-Src activity, a signaling intermediate involved in cell cycle progression, motility, angiogenesis and survival. The function of Ron has been shown to be important for embryological development as well as implicated in the progression and metastasis of tumors.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~32kDa

Notes: For research use only, not for use in diagnostic procedure.