Skip to product information
1 of 1

Bioworld

CD137 Recombinant Protein - NCP0263

CD137 Recombinant Protein - NCP0263

Regular price $1,152.00 CAD
Regular price Sale price $1,152.00 CAD
Sale Sold out
Size
Quantity

Get a quote

CD137 Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0263-500, NCP0263-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: TNFRSF9 is a member of the tumor necrosis factor receptor superfamily. It is also called 4-1BB or CD137. 4-1BB/CD137/TNFRSF9 is expressed in activated CD4+ and CD8+ T cells, natural killer cells and dendritic cells. The ligand 4-1BBL/CD137L/TNFSF9 on antigen presenting cells binds to 4-1BB/CD137/TNFRSF9 and costimμlates the activation of T cells. The binding of agonistic antibodies to 4-1BB/CD137/TNFRSF9 also leads to costimμlation for T cell activation. Studies have shown the effectiveness of targeting 4-1BB/CD137/TNFRSF9 by its agonistic antibodies in cancer immunotherapy.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~24kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: Q07011

Tag: His-tag

Amino Acid Sequence: CTGCAGGATCCGTGTAGCAATTGCCCGGCAGGTACCTTCTGTGATAATAATCGCAATCAGATCTGTAGCCCGTGTCCGCCGAATAGCTTCAGTAGCGCCGGCGGTCAGCGCACCTGTGATATCTGTCGCCAGTGTAAAGGCGTGTTCCGTACCCGTAAAGAATGCAGCAGCACCAGTAATGCCGAATGTGATTGTACCCCGGGCTTCCATTGCCTGGGCGCAGGTTGTAGCATGTGTGAACAGGATTGCAAACAGGGTCAGGAACTGACCAAAAAAGGCTGTAAAGATTGCTGCTTCGGTACCTTCAATGATCAGAAACGCGGTATCTGTCGTCCGTGGACCAATTGCAGCCTGGATGGCAAAAGTGTTCTGGTTAATGGTACCAAAGAACGTGATGTTGTGTGCGGTCCGAGTCCGGCAGATCTGAGCCCGGGCGCAAGCAGTGTGACCCCGCCTGCTCCGGCACGTGAACCGGGTCATAGTCCGCAG

Expression Vector: pet-22b(+)

Research Use Only

View full details