Product Description

CD147 Recombinant Protein

Catalogue Number: NCP0177-500, NCP0177-1000

Sizes: 500ug, 1mg

Swiss-Prot: P35613

Host: E.coli

Tag: His-tag

AA Sequence: GAACCGGGTACCGTGTTCACCACCGTTGAAGATCTGGGCAGCAAAATTCTGCTGACCTGTAGCCTGAATGATAGCGCCACCGAAGTGACCGGCCATCGTTGGCTGAAAGGCGGCGTGGTTCTGAAAGAAGATGCCCTGCCGGGTCAGAAAACCGAATTCAAAGTTGATAGCGATGATCAGTGGGGCGAATATAGCTGCGTGTTCCTGCCGGAACCGATGGGCACCGCCAATATTCAGCTGCATGGTCCGCCGCGTGTGAAAGCCGTTAAAAGTAGTGAACATATTAACGAAGGTGAAACCGCCATGCTGGTGTGTAAAAGTGAAAGTGTTCCGCCGGTGACCGATTGGGCATGGTATAAAATTACCGATAGCGAAGATAAAGCCCTGATGAATGGTAGCGAAAGTCGCTTCTTCGTTAGTAGTAGTCAGGGTCGCAGCGAACTGCATATTGAAAATCTGAATATGGAAGCCGATCCGGGCCAGTATCGCTGCAATGGTACCAGCAGTAAAGGTAGCGATCAGGCAATTATTACCCTGCGCGTTCGCAGCCATCTGGCC

Restriction Sites: NdeI-XhoI

Background: Basigin (EMMPRIN, CD147) is a type I integral membrane receptor protein belonging to the immunoglobulin superfamily. Basigin is a glycosylated protein with four known isoforms, of which isoform 2 is the most abundantly expressed. Multiple functions have been ascribed to Basigin; foremost among these is stimulating the secretion of extracellular matrix metalloproteinases by adjacent fibroblasts, a function which has been implicated in promoting tumor progression. Research studies have shown that Basigin is overexpressed by many tumor cells, and its expression level may correlate with tumor malignancy. A recent study identified the BASIGIN gene as a regulatory target of Slug, suggesting a role for Basigin in the process of epithelial-mesenchymal transition. Basigin has also been identified as a marker for a subset of highly suppressive regulatory T cells, and as an obligate receptor for the malarial parasite Plasmodium falciparum on human erythrocytes.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~24kDa

Notes: For research use only, not for use in diagnostic procedure.