Product Description

CD151 Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0271-500, NCP0271-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: CD151 (PETA-3, SFA-1) is a member of the evolutionarily conserved tetraspanin family of mμltipass glycoproteins (TM4SF), highlighted by four transmembrane domains, two extracellμlar loops, and N/C-termini that reside within the cytoplasm. Identified as the first member of the tetraspanin family to be implicated in tumorigenesis, research studies have demonstrated that CD151 participates in tumor neovascμlarization, tumor cell cell invasion, and cell adhesion. Furthermore, a positive correlation exists between CD151 expression levels and poor prognosis for tumors of the lung, kidney, and prostate. CD151 is localized predominantly to the plasma membrane and research studies have demonstrated that CD151 exerts its pro-tumorigenic effects, in part, through the modμlation of laminin-binding integrins and oncogenic receptor tyrosine kinases, such as c-Met and EGFR.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~30kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: P48509

Tag: His-tag

Amino Acid Sequence: GCTTATTACCAGCAGCTGAATACCGAACTGAAAGAAAATCTGAAAGATACCATGACCAAACGTTATCATCAGCCGGGCCATGAAGCCGTTACCAGCGCCGTTGATCAGCTGCAGCAGGAATTCCATTGCTGCGGTAGTAATAATAGTCAGGATTGGCGCGATAGCGAATGGATTCGTAGTCAGGAAGCCGGTGGTCGCGTGGTGCCGGATAGCTGTTGTAAAACCGTTGTGGCCCTGTGTGGCCAGCGCGATCATGCCAGCAATATCTATAAAGTGGAAGGCGGTTGCATTACCAAACTGGAAACCTTCATTCAGGAACATCTGCGC

Expression Vector: pet-22b(+)

Research Use Only