Product Description

CD151 Recombinant Protein

Catalogue Number: NCP0271-500, NCP0271-1000

Sizes: 500ug, 1mg

Swiss-Prot: P48509

Host: E.coli

Tag: His-tag

AA Sequence: GCTTATTACCAGCAGCTGAATACCGAACTGAAAGAAAATCTGAAAGATACCATGACCAAACGTTATCATCAGCCGGGCCATGAAGCCGTTACCAGCGCCGTTGATCAGCTGCAGCAGGAATTCCATTGCTGCGGTAGTAATAATAGTCAGGATTGGCGCGATAGCGAATGGATTCGTAGTCAGGAAGCCGGTGGTCGCGTGGTGCCGGATAGCTGTTGTAAAACCGTTGTGGCCCTGTGTGGCCAGCGCGATCATGCCAGCAATATCTATAAAGTGGAAGGCGGTTGCATTACCAAACTGGAAACCTTCATTCAGGAACATCTGCGC

Restriction Sites: NdeI-XhoI

Background: CD151 (PETA-3, SFA-1) is a member of the evolutionarily conserved tetraspanin family of multipass glycoproteins (TM4SF), highlighted by four transmembrane domains, two extracellular loops, and N/C-termini that reside within the cytoplasm. Identified as the first member of the tetraspanin family to be implicated in tumorigenesis, research studies have demonstrated that CD151 participates in tumor neovascularization, tumor cell cell invasion, and cell adhesion. Furthermore, a positive correlation exists between CD151 expression levels and poor prognosis for tumors of the lung, kidney, and prostate. CD151 is localized predominantly to the plasma membrane and research studies have demonstrated that CD151 exerts its pro-tumorigenic effects, in part, through the modulation of laminin-binding integrins and oncogenic receptor tyrosine kinases, such as c-Met and EGFR.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~30kDa

Notes: For research use only, not for use in diagnostic procedure.