Product Description

CD152 Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0272-500, NCP0272-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: Cytotoxic T-lymphocyte protein 4 (CTLA-4, CD152) is an Ig superfamily member that negatively regμlates early T cell activation. The CTLA-4 protein is primarily expressed on T cells, including CD8+ cytotoxic T cells, CD4+ helper T cells, and CD4+/FoxP3+ regμlatory T cells. CTLA-4 protein competes with CD28 for B7.1 (CD80) and B7.2 (CD86) binding at the cell surface, which resμlts in the down regμlation of T cell activity. The activation of SHP-2 and PP2A downstream of CTLA-4 attenuates TCR signaling. Research studies indicate that CTLA4 knockout mice display lymphoproliferative disorders leading to early death, confirming the role of CTLA-4 as a negative regμlator of T cells. Mutations in the corresponding CTLA4 gene are associated with mμltiple disorders, including insμlin-dependent diabetes mellitus, Graves disease, Hashimoto thyroiditis, celiac disease, systemic lupus erythematosus, and type V autoimmune lymphoproliferative syndrome. Additional studies demonstrate that CTLA-4 blockade is an effective strategy for tumor immunotherapy.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~17kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: P16410

Tag: His-tag

Amino Acid Sequence: AAGGCAATGCATGTTGCCCAGCCGGCCGTGGTTCTGGCCAGTAGTCGTGGTATTGCAAGCTTCGTGTGCGAATATGCCAGCCCGGGTAAAGCAACCGAAGTTCGTGTGACCGTGCTGCGTCAGGCAGATAGCCAGGTTACCGAAGTGTGCGCCGCCACCTATATGATGGGTAATGAACTGACCTTCCTGGATGATAGTATCTGTACCGGTACCAGTAGTGGTAATCAGGTTAATCTGACCATTCAGGGTCTGCGCGCCATGGATACCGGCCTGTATATCTGTAAAGTTGAACTGATGTATCCGCCGCCGTATTATCTGGGCATTGGCAATGGCACCCAGATCTATGTGATTGATCCGGAACCGTGCCCGGATAGTGAT

Expression Vector: pet-22b(+)

Research Use Only