Product Description

CD158a Recombinant Protein

Catalogue Number: NCP0282-500, NCP0282-1000

Sizes: 500ug, 1mg

Swiss-Prot: P43626

Host: E.coli

Tag: His-tag

AA Sequence: CATGAAGGTGTGCATCGTAAACCGAGTCTGCTGGCCCATCCGGGTCCGCTGGTGAAAAGCGAAGAAACCGTGATTCTGCAGTGCTGGAGCGATGTTATGTTCGAACACTTCCTGCTGCATCGCGAAGGCATGTTCAATGATACCCTGCGCCTGATTGGTGAACATCATGATGGTGTTAGCAAAGCAAACTTCAGTATTAGCCGTATGACCCAGGATCTGGCCGGTACCTATCGTTGCTATGGCAGCGTTACCCATAGTCCGTATCAGGTGAGTGCACCGAGCGATCCGCTGGATATTGTGATTATTGGTCTGTATGAAAAGCCGAGCCTGAGCGCACAGCCGGGTCCGACAGTGCTGGCCGGTGAAAATGTTACCCTGAGTTGCAGCAGCCGTAGTAGTTATGATATGTATCATCTGAGCCGTGAAGGTGAAGCCCATGAACGCCGTCTGCCGGCCGGTCCTAAAGTGAATGGTACCTTCCAGGCCGACTTCCCGCTGGGCCCGGCAACACATGGCGGCACATATCGCTGCTTCGGCAGCTTCCATGATAGCCCGTATGAATGGAGTAAAAGTAGCGATCCGTTACTGGTTAGTGTTACCGGCAATCCGAGCAATAGCTGGCCGAGCCCGACCGAACCGAGCAGTAAAACCGGTAATCCGCGCCATCTGCAT

Restriction Sites: NdeI-XhoI

Background: NKAT (NK-associated transcripts) gene products, known as killer immunoglobulin-like receptors or KIRs, downregulate the cytotoxicity of NK cells upon recognition of specific class I major histocompatibility complex (MHC) molecules on target cells. This family of receptors is characterized by an extracellular region with two to three immunoglobulin-superfamily domains and a cytoplasmic domain with an antigen receptor activation motif (ARAM). KIRs and other inhibitory receptors also possess a common cytoplasmic sequence (I/VxYxxL/V) known as an ITIM (immunoreceptor tyrosine-based inhibitory motif). The human inhibitory natural killer cell immunoglobulin-like
receptor 2DL1, also designated KIR2DL1, CL-42, NKAT1, P58.1 or CD158a long form, is a 348 amino acid type I transmembrane protein. KIR2DL1 can bind human leukocyte antigen-C (HLA-C) via both polar and hydrophobic interactions through Met 44 in a binding pocket that coordinates Lys 80 of HLA-C.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~30kDa

Notes: For research use only, not for use in diagnostic procedure.