Product Description

CD158a Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0282-500, NCP0282-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: NKAT (NK-associated transcripts) gene products, known as killer immunoglobμlin-like receptors or KIRs, downregμlate the cytotoxicity of NK cells upon recognition of specific class I major histocompatibility complex (MHC) molecμles on target cells. This family of receptors is characterized by an extracellμlar region with two to three immunoglobμlin-superfamily domains and a cytoplasmic domain with an antigen receptor activation motif (ARAM). KIRs and other inhibitory receptors also possess a common cytoplasmic sequence (I/VxYxxL/V) known as an ITIM (immunoreceptor tyrosine-based inhibitory motif). The human inhibitory natural killer cell immunoglobμlin-like
receptor 2DL1, also designated KIR2DL1, CL-42, NKAT1, P58.1 or CD158a long form, is a 348 amino acid type I transmembrane protein. KIR2DL1 can bind human leukocyte antigen-C (HLA-C) via both polar and hydrophobic interactions through Met 44 in a binding pocket that coordinates Lys 80 of HLA-C.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~30kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: P43626

Tag: His-tag

Amino Acid Sequence: CATGAAGGTGTGCATCGTAAACCGAGTCTGCTGGCCCATCCGGGTCCGCTGGTGAAAAGCGAAGAAACCGTGATTCTGCAGTGCTGGAGCGATGTTATGTTCGAACACTTCCTGCTGCATCGCGAAGGCATGTTCAATGATACCCTGCGCCTGATTGGTGAACATCATGATGGTGTTAGCAAAGCAAACTTCAGTATTAGCCGTATGACCCAGGATCTGGCCGGTACCTATCGTTGCTATGGCAGCGTTACCCATAGTCCGTATCAGGTGAGTGCACCGAGCGATCCGCTGGATATTGTGATTATTGGTCTGTATGAAAAGCCGAGCCTGAGCGCACAGCCGGGTCCGACAGTGCTGGCCGGTGAAAATGTTACCCTGAGTTGCAGCAGCCGTAGTAGTTATGATATGTATCATCTGAGCCGTGAAGGTGAAGCCCATGAACGCCGTCTGCCGGCCGGTCCTAAAGTGAATGGTACCTTCCAGGCCGACTTCCCGCTGGGCCCGGCAACACATGGCGGCACATATCGCTGCTTCGGCAGCTTCCATGATAGCCCGTATGAATGGAGTAAAAGTAGCGATCCGTTACTGGTTAGTGTTACCGGCAATCCGAGCAATAGCTGGCCGAGCCCGACCGAACCGAGCAGTAAAACCGGTAATCCGCGCCATCTGCAT

Expression Vector: pet-22b(+)

Research Use Only