Product Description

CD158b2 Recombinant Protein

Catalogue Number: NCP0283-500, NCP0283-1000

Sizes: 500ug, 1mg

Swiss-Prot: P43628

Host: E.coli

Tag: His-tag

AA Sequence: CATGAAGGCGTTCATCGCAAACCGAGTCTGCTGGCACATCCGGGTCCGCTGGTTAAAAGCGAAGAAACCGTGATTCTGCAGTGCTGGAGTGATGTTCGCTTCCAGCACTTCCTGCTGCATCGCGAAGGCAAATTCAAAGATACCCTGCATCTGATTGGCGAACATCATGATGGTGTTAGCAAAGCCAACTTCAGCATTGGTCCGATGATGCAGGATCTGGCCGGTACCTATCGCTGCTATGGCAGTGTGACCCATAGTCCGTATCAGCTGAGTGCCCCGAGTGATCCGCTGGATATTGTTATTACCGGCCTGTATGAAAAACCGAGTCTTAGCGCCCAGCCGGGTCCGACCGTTCTGGCTGGTGAAAGTGTTACCCTGAGTTGTAGTAGCCGCAGCAGTTATGATATGTATCATCTGAGCCGCGAAGGTGAAGCCCATGAACGTCGCTTCAGCGCAGGCCCGAAAGTGAATGGCACCTTCCAGGCCGACTTCCCGCTGGGTCCGGCCACACATGGCGGTACCTATCGTTGCTTCGGCAGCTTCCGCGATAGTCCGTATGAATGGAGTAATAGCAGTGATCCGTTACTGGTGAGCGTGACCGGCAATCCGAGCAATAGTTGGCCGAGTCCGACCGAACCGAGCAGCGAAACCGGTAATCCGCGCCATCTGCAT

Restriction Sites: NdeI-XhoI

Background: Killer cell immunoglobulin-like receptors (KIRs) are type 1 transmembrane glycoproteins expressed by natural killer cells and subsets of CD4, CD8, and γδ T cells. Analogous to the diversity of their human leucocyte antigen class I (HLA Class I) ligands, the KIR genes are polymorphic and the content of the KIR gene cluster varies among haplotypes, although several "framework" genes are found in all haplotypes. The KIR proteins are characterized by the number of extracellular immunoglobulin-superfamily domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain lack an ITIM and instead transduce activating signals. KIR proteins play an important role in the regulation of the immune response. Combinations of KIR and HLA class I variants influence susceptibility to autoimmunity and infectious disease, as well as outcomes of haematopoietic stem cell transplantation.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~30kDa

Notes: For research use only, not for use in diagnostic procedure.