Product Description

CD158d Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0279-500, NCP0279-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: NKAT (NK-associated transcripts) gene products, known as killer immunoglobμlin-like receptors or KIRs, downregμlate the cytotoxicity of NK cells upon recognition of specific class I major histocompatibility complex (MHC) molecμles on target cells. This family of receptors is characterized by an extracellμlar region with two to three immunoglobμlin-superfamily domains and a cytoplasmic domain with an antigen receptor activation motif (ARAM). KIRs and other inhibitory receptors also possess a common cytoplasmic sequence (I/VxYxxL/V) known as an ITIM (immunoreceptor tyrosine-based inhibitory motif). The human inhibitory human killer cell immunoglobμlin-like receptor 2DL4 (KIR2DL4), also referred to as 2DL4 or CD158d, triggers potent IFN-γ responses but weak cytotoxicity in resting NK cells because of the low stoichiometric association with γ

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~28kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: Q99706

Tag: His-tag

Amino Acid Sequence: TGGGCACATGTTGGTGGTCAGGATAAACCGTTCTGCAGCGCATGGCCGAGCGCCGTTGTTCCGCAGGGTGGTCATGTGACCCTGCGTTGTCATTATCGTCGTGGCTTCAATATCTTCACCCTGTATAAAAAAGACGGCGTTCCGGTTCCGGAACTGTATAATCGTATCTTCTGGAATAGCTTCCTGATTAGCCCGGTGACCCCGGCCCATGCAGGCACATATCGTTGCCGCGGCTTCCATCCGCATAGCCCGACCGAATGGAGCGCACCGAGCAATCCGCTGGTGATTATGGTTACCGGCCTGTATGAAAAACCGAGTCTGACCGCCCGTCCGGGTCCGACAGTGCGTGCAGGTGAAAATGTGACCCTGAGTTGTAGCAGCCAGAGTAGCTTCGATATCTATCATCTGAGTCGTGAAGGTGAAGCCCATGAACTGCGTCTGCCGGCAGTTCCGAGCATTAATGGCACCTTCCAGGCAGACTTCCCGCTGGGTCCGGCAACCCATGGTGAAACCTATCGCTGCTTCGGTAGCTTCCATGGTAGCCCGTATGAATGGAGCGATCCGAGCGATCCGCTGCCGGTGAGCGTGACCGGTAATCCGAGTAGCAGTTGGCCGAGCCCGACCGAGCCGAGCTTCAAAACCGGCATTGCCCGCCATCTGCAT

Expression Vector: pet-22b(+)

Research Use Only