Product Description

CD159a Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0284-500, NCP0284-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: The activity of natural killer (NK) cells is regμlated by members of mμltiple receptor families that recognize class I MHC molecμles, such as the killer cell inhibitory receptor/leukocyte immunoglobμlin-like receptor (KIR/LIR) family and the C-type lectin superfamily. The KIR/LIR family includes p91A (also designated pp130 or PIR-B, for paired immunoglobμlin-like receptor-B) and p91B (also designated PIR-A). p91A acts as an inhibitory receptor through interactions with SHP-1, whereas p91B acts as an activating receptor. CD94, NKG2 and Ly-49 are members of the C-type lectin superfamily of type II membrane glycoproteins. CD94 forms heterodimers with NKG2 isoforms on
the surface of NK cells, whereas Ly-49 isoforms form homodimers. NKG2-D, expressed on NK cells, gdT cells and CD8+αβ T cells, is a receptor for the stress inducible protein MICA, an antigen frequently expressed in epithelial tumors.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~15kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: P26715

Tag: His-tag

Amino Acid Sequence: CCTAGTACCCTGATTCAGCGCCATAATAATAGTAGTCTGAATACCCGCACCCAGAAAGCACGCCATTGCGGCCATTGCCCGGAAGAATGGATTACCTATAGCAATAGCTGTTATTATATCGGCAAAGAACGTCGTACCTGGGAAGAAAGCCTGCTGGCCTGTACCAGTAAAAATAGTAGTCTTCTGAGTATTGACAACGAAGAAGAAATGAAATTCCTGAGTATTATCAGTCCGAGTAGTTGGATTGGTGTGTTCCGCAATAGTAGTCATCATCCGTGGGTTACCATGAATGGTCTGGCCTTCAAACATGAAATTAAAGATAGTGATAACGCGGAACTGAATTGCGCAGTTCTGCAGGTGAATCGCCTGAAAAGTGCCCAGTGTGGTAGTAGCATTATCTATCATTGCAAACATAAGCTG

Expression Vector: pet-22b(+)

Research Use Only