Product Description

CD160 Recombinant Protein

Catalogue Number: NCP0181-500, NCP0181-1000

Sizes: 500ug, 1mg

Swiss-Prot: O95971

Host: E.coli

Tag: His-tag

AA Sequence: GGTTGCATTAATATCACCAGTAGTGCAAGCCAGGAAGGTACCCGCCTGAATCTGATCTGTACCGTGTGGCATAAAAAAGAAGAAGCCGAAGGCTTCGTTGTGTTCCTGTGTAAAGATCGTAGTGGTGATTGCAGTCCGGAAACCAGCCTGAAACAGCTGCGCCTGAAACGTGATCCGGGCATTGATGGTGTTGGCGAAATTAGTAGCCAGCTGATGTTCACCATTAGCCAGGTTACCCCGCTGCATAGTGGCACCTATCAGTGCTGCGCACGTAGTCAGAAAAGTGGTATTCGTCTGCAGGGCCACTTCTTCAGTATTCTGTTCACCGAAACCGGCAATTATACCGTTACCGGCCTGAAACAGCGCCAGCATCTGGAATTCAGCCATAATGAAGGCACCCTGAGT

Restriction Sites: NdeI-XhoI

Background: CD160 antigen: rceptor on immune cells capable to deliver stimulatory or inhibitory signals that regulate cell activation and differentiation. Exists as a GPI-anchored and as a transmembrane form, each likely initiating distinct signaling pathways via phosphoinositol 3-kinase in activated NK cells and via LCK and CD247/CD3 zeta chain in activated T cells.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~15kDa

Notes: For research use only, not for use in diagnostic procedure.