Product Description

CD160 Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0181-500, NCP0181-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: CD160 antigen: rceptor on immune cells capable to deliver stimμlatory or inhibitory signals that regμlate cell activation and differentiation. Exists as a GPI-anchored and as a transmembrane form, each likely initiating distinct signaling pathways via phosphoinositol 3-kinase in activated NK cells and via LCK and CD247/CD3 zeta chain in activated T cells.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~15kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: O95971

Tag: His-tag

Amino Acid Sequence: GGTTGCATTAATATCACCAGTAGTGCAAGCCAGGAAGGTACCCGCCTGAATCTGATCTGTACCGTGTGGCATAAAAAAGAAGAAGCCGAAGGCTTCGTTGTGTTCCTGTGTAAAGATCGTAGTGGTGATTGCAGTCCGGAAACCAGCCTGAAACAGCTGCGCCTGAAACGTGATCCGGGCATTGATGGTGTTGGCGAAATTAGTAGCCAGCTGATGTTCACCATTAGCCAGGTTACCCCGCTGCATAGTGGCACCTATCAGTGCTGCGCACGTAGTCAGAAAAGTGGTATTCGTCTGCAGGGCCACTTCTTCAGTATTCTGTTCACCGAAACCGGCAATTATACCGTTACCGGCCTGAAACAGCGCCAGCATCTGGAATTCAGCCATAATGAAGGCACCCTGAGT

Expression Vector: pet-22b(+)

Research Use Only