Product Description

CD161 Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0285-500, NCP0285-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: CD161/KLRB1 (Killer cell lectin-like receptor subfamily B member 1, also known as CLEC5B and NKR-P1A) is a type II transmembrane protein that is expressed on the majority of Natural Killer (NK) cells, NK T cells, and some T lymphocytes. CD161/KLRB1 is also expressed on Th17 cells, promotes their generation, and modμlates their function. Engagement with its ligand lectin-like transcript 1 (LLT1) inhibits NK cell function, while LLT1 and CD161/KLRB1 interaction in the presence of a TCR signal enhances IFN-gamma production by T cells. There are several different CD161 isoforms in rodents and some function as activating receptors as well.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~22kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: Q12918

Tag: His-tag

Amino Acid Sequence: CAGAAAAGCAGTATTGAAAAGTGTAGCGTTGATATTCAGCAGAGTCGCAATAAAACCACCGAACGTCCGGGCCTGCTGAATTGCCCGATCTATTGGCAGCAGCTGCGTGAAAAATGCCTGCTGTTCAGCCATACCGTTAATCCGTGGAATAATAGTCTGGCCGATTGCAGTACCAAAGAAAGTAGTCTGCTGCTGATTCGTGATAAAGATGAACTGATTCATACCCAGAATCTGATTCGTGACAAAGCCATTCTGTTCTGGATTGGCCTGAACTTCAGCCTGAGCGAAAAAAATTGGAAATGGATTAATGGCAGCTTCCTGAATAGCAATGATCTGGAAATTCGTGGTGATGCAAAAGAAAATAGTTGCATTAGTATCAGCCAGACCAGTGTGTATAGTGAATATTGCAGTACCGAAATTCGTTGGATCTGTCAGAAAGAACTGACCCCGGTGCGCAATAAAGTGTATCCGGATAGC

Expression Vector: pet-22b(+)

Research Use Only