Product Description

CD161 Recombinant Protein

Catalogue Number: NCP0285-500, NCP0285-1000

Sizes: 500ug, 1mg

Swiss-Prot: Q12918

Host: E.coli

Tag: His-tag

AA Sequence: CAGAAAAGCAGTATTGAAAAGTGTAGCGTTGATATTCAGCAGAGTCGCAATAAAACCACCGAACGTCCGGGCCTGCTGAATTGCCCGATCTATTGGCAGCAGCTGCGTGAAAAATGCCTGCTGTTCAGCCATACCGTTAATCCGTGGAATAATAGTCTGGCCGATTGCAGTACCAAAGAAAGTAGTCTGCTGCTGATTCGTGATAAAGATGAACTGATTCATACCCAGAATCTGATTCGTGACAAAGCCATTCTGTTCTGGATTGGCCTGAACTTCAGCCTGAGCGAAAAAAATTGGAAATGGATTAATGGCAGCTTCCTGAATAGCAATGATCTGGAAATTCGTGGTGATGCAAAAGAAAATAGTTGCATTAGTATCAGCCAGACCAGTGTGTATAGTGAATATTGCAGTACCGAAATTCGTTGGATCTGTCAGAAAGAACTGACCCCGGTGCGCAATAAAGTGTATCCGGATAGC

Restriction Sites: NdeI-XhoI

Background: CD161/KLRB1 (Killer cell lectin-like receptor subfamily B member 1, also known as CLEC5B and NKR-P1A) is a type II transmembrane protein that is expressed on the majority of Natural Killer (NK) cells, NK T cells, and some T lymphocytes. CD161/KLRB1 is also expressed on Th17 cells, promotes their generation, and modulates their function. Engagement with its ligand lectin-like transcript 1 (LLT1) inhibits NK cell function, while LLT1 and CD161/KLRB1 interaction in the presence of a TCR signal enhances IFN-gamma production by T cells. There are several different CD161 isoforms in rodents and some function as activating receptors as well.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~22kDa

Notes: For research use only, not for use in diagnostic procedure.