Product Description

CD162 Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0286-500, NCP0286-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: PSGL-1 (P-Selectin glycoprotein ligand, also designated CD162), exists as a disμlfide-linked homodimer. PSGL-1 is a type 1 membrane protein that localizes on the tips of microvilli of leukocytes. Its extracellμlar domain is rich in serines, threonines and prolines, and includes a series of 15 and 16 ecameric repeats in HL-60 and U-937 cells, and human leukocytes, respectively. Although PSGL-1 appears to be the sole receptor for P-Selectin on human hematopoietic cells, it also interacts with E-Selectin through a unique binding site. In order to bind PSGL-1 to either E-Selectin or P-Selectin, PSGL-1 must be sialylated and fucosylated. PSLG-1 is a mucin-like molecμle, much like leukosialin (CD43), CD164 and CD34. These proteins belong to an emerging family of cell adhesion receptors called sialomucins, which transduce negative signals in hematopoietic cells.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~53kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: Q14242

Tag: His-tag

Amino Acid Sequence: CAGGCAACCGAATATGAATATCTGGATTATGACTTCCTGCCGGAAACCGAACCGCCGGAAATGCTGCGCAATAGTACCGATACCACCCCGCTGACCGGTCCGGGTACCCCTGAAAGCACCACCGTGGAACCGGCAGCACGTCGCAGTACCGGTCTGGATGCAGGTGGCGCAGTTACCGAACTGACCACCGAACTGGCCAATATGGGTAATCTGAGCACCGATAGTGCAGCCATGGAAATTCAGACCACCCAGCCGGCAGCAACCGAAGCACAGACCACCCAACCGGTTCCGACCGAAGCACAAACCACCCCGTTAGCCGCAACCGAAGCGCAGACCACCCGCCTGACCGCAACCGAAGCCCAGACCACCCCGCTTGCAGCAACCGAGGCACAGACCACACCGCCGGCAGCCACCGAAGCCCAAACCACCCAGCCTACCGGCCTGGAAGCACAGACAACCGCCCCGGCAGCCATGGAGGCACAGACAACAGCACCGGCAGCCATGGAAGCACAGACGACCCCGCCGGCAGCAATGGAAGCCCAGACAACCCAGACCACCGCCATGGAAGCGCAGACAACCGCACCGGAAGCAACCGAAGCTCAGACCACCCAGCCAACCGCAACCGAGGCCCAGACCACACCTCTGGCCGCCATGGAAGCTCTGAGCACCGAACCGAGCGCCACCGAAGCGCTGAGCATGGAACCGACCACCAAACGTGGTCTGTTCATTCCGTTCAGCGTTAGCAGTGTGACCCATAAAGGCATTCCGATGGCAGCCAGCAATCTGAGCGTTAATTATCCGGTGGGCGCACCGGATCATATTAGTGTTAAACAGTGT

Expression Vector: pet-22b(+)

Research Use Only