Product Description

CD164 Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0288-500, NCP0288-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: CD164 is a mucin-like cell surface glycoprotein that facilitates adhesion of CD34+ cells and serves as a negative regμlator of hematopoietic progenitor cell proliferation. Human CD164 in CD34+CD38+ hematopoietic progenitor and epithelial cell lines localizes to endosomes and lysosomes, with low concentrations also appearing at the cell surface.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~24kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: Q04900

Tag: His-tag

Amino Acid Sequence: GATAAGAACACCACCCAGCATCCGAATGTGACCACCCTGGCACCGATTAGTAATGTTACCAGTGCACCGGTGACCAGTCTGCCGCTGGTTACCACCCCGGCACCGGAAACCTGTGAAGGTCGTAATAGTTGTGTTAGCTGCTTCAATGTGAGCGTGGTGAATACCACCTGCTTCTGGATTGAATGCAAAGATGAAAGCTATTGTAGCCATAATAGCACCGTTAGCGATTGCCAGGTGGGCAATACCACCGACTTCTGTAGTGTTAGTACCGCCACCCCGGTTCCGACCGCAAATAGCACCGCCAAACCGACCGTGCAGCCGAGTCCGAGCACCACCAGCAAAACCGTTACCACCAGCGGCACCACCAATAATACCGTGACCCCGACCAGTCAGCCGGTTCGTAAAAGCACCTTCGAT

Expression Vector: pet-22b(+)

Research Use Only