Product Description

CD164 Recombinant Protein

Catalogue Number: NCP0288-500, NCP0288-1000

Sizes: 500ug, 1mg

Swiss-Prot: Q04900

Host: E.coli

Tag: His-tag

AA Sequence: GATAAGAACACCACCCAGCATCCGAATGTGACCACCCTGGCACCGATTAGTAATGTTACCAGTGCACCGGTGACCAGTCTGCCGCTGGTTACCACCCCGGCACCGGAAACCTGTGAAGGTCGTAATAGTTGTGTTAGCTGCTTCAATGTGAGCGTGGTGAATACCACCTGCTTCTGGATTGAATGCAAAGATGAAAGCTATTGTAGCCATAATAGCACCGTTAGCGATTGCCAGGTGGGCAATACCACCGACTTCTGTAGTGTTAGTACCGCCACCCCGGTTCCGACCGCAAATAGCACCGCCAAACCGACCGTGCAGCCGAGTCCGAGCACCACCAGCAAAACCGTTACCACCAGCGGCACCACCAATAATACCGTGACCCCGACCAGTCAGCCGGTTCGTAAAAGCACCTTCGAT

Restriction Sites: NdeI-XhoI

Background: CD164 is a mucin-like cell surface glycoprotein that facilitates adhesion of CD34+ cells and serves as a negative regulator of hematopoietic progenitor cell proliferation. Human CD164 in CD34+CD38+ hematopoietic progenitor and epithelial cell lines localizes to endosomes and lysosomes, with low concentrations also appearing at the cell surface.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~24kDa

Notes: For research use only, not for use in diagnostic procedure.