Product Description

CD172a Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0294-500, NCP0294-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: SHP-substrate 1 (SHPS1, SIRPα) is a single-pass membrane protein and member of both the immunoglobμlin superfamily and the signal regμlatory protein (SIRP) family. Following growth hormone stimμlation or integrin binding, SHPS1 is phosphorylated at several tyrosine residues within its cytoplasmic tail. These phosphorylation events promote association between SHPS1 and mμltiple signaling proteins, including SHP-1, SHP-2, Grb2 and Shc via their SH2 domains. Recruitment of SHP-1 and SHP-2 resμlts in SHPS1 dephosphorylation and suppression of tyrosine kinase signaling. The tyrosine kinase JAK2 associates with SHPS1 via its carboxy terminus and phosphorylates SHPS1 in response to extracellμlar stimμli. Research studies show that Src associates with and may phosphorylate SHPS1 in response to insμlin. In macrophages, SHPS1 can form a complex with the Src pathway adaptor protein SKAP2, Fyn-binding protein FYB, and the tyrosine kinase PYK2. The SHPS1 extracellμlar domain contains at least three IgG-like domains that interact with CD47, a ubiquitously expressed, integrin-associated protein that acts as a repressive cue in both immune and neuronal cells. The interaction between CD47 and SHPS1 on opposing cells can inhibit cellμlar migration, promote "tethering" between macrophages and target cells during engμlfment, facilitate self versus non-self recognition, and maintain immune homeostasis (12). SHPS1 plays a critical role in modμlating the immune response and inflammation, and may play a role in neuronal development. The interaction between SHPS1 and CD47 may be an exploitable target in cancer therapy.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~38kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: P78324

Tag: His-tag

Amino Acid Sequence: GAAGAAGAACTGCAGGTGATTCAGCCGGATAAAAGCGTTCTGGTTGCAGCAGGTGAAACCGCAACCCTGCGCTGTACCGCCACCAGCCTGATTCCGGTTGGTCCGATTCAGTGGTTCCGCGGCGCAGGTCCGGGCAGAGAACTGATCTATAATCAGAAAGAAGGTCACTTCCCGCGCGTTACCACCGTTAGTGATCTGACCAAACGTAATAATATGGACTTCAGTATTCGCATTGGTAATATTACCCCGGCAGATGCAGGTACCTATTATTGCGTGAAATTCCGTAAAGGTAGTCCGGATGATGTTGAATTCAAAAGCGGCGCAGGCACCGAACTGAGTGTGCGCGCCAAACCGAGTGCCCCGGTTGTTAGTGGCCCGGCAGCCCGTGCCACCCCTCAACATACCGTTAGCTTCACCTGTGAAAGCCATGGCTTCAGTCCGCGTGATATTACCCTGAAATGGTTCAAAAATGGTAATGAACTGAGCGACTTCCAGACCAATGTTGATCCGGTTGGTGAAAGTGTTAGCTATAGTATTCATAGCACCGCAAAAGTGGTTCTGACCCGCGAAGATGTTCATAGCCAGGTTATCTGTGAAGTGGCACATGTTACCCTGCAGGGTGATCCGCTGCGCGGTACCGCAAATCTGAGCGAAACCATTCGCGTTCCGCCGACCCTGGAAGTGACCCAGCAGCCGGTTCGTGCCGAAAATCAGGTTAATGTTACCTGCCAGGTTCGCAAATTCTATCCGCAGCGTCTGCAGCTGACCTGGCTGGAAAATGGTAATGTTAGTCGCACCGAAACCGCAAGTACCGTTACCGAAAATAAAGATGGTACCTATAATTGGATGAGTTGGCTGCTGGTGAATGTGAGTGCCCATCGCGATGATGTGAAACTGACCTGCCAGGTGGAACATGATGGTCAGCCGGCAGTGAGCAAAAGCCATGATCTGAAAGTTAGTGCCCATCCGAAAGAACAGGGTAGTAATACCGCCGCAGAAAATACCGGCAGCAATGAACGTAATATCTAT

Expression Vector: pet-22b(+)

Research Use Only