Skip to product information
1 of 1

BioWorld

CD172b Recombinant Protein - NCP0293

CD172b Recombinant Protein - NCP0293

Regular price $1,050.83 CAD
Regular price Sale price $1,050.83 CAD
Sale Sold out
Size
Quantity

Get a quote

CD172b Recombinant Protein

Catalogue Number: NCP0293-500, NCP0293-1000

Sizes: 500ug, 1mg

Swiss-Prot: O00241

Host: E.coli

Tag: His-tag

AA Sequence: GAAGATGAACTGCAGGTTATTCAGCCGGAAAAAAGCGTGAGCGTGGCAGCCGGTGAAAGCGCAACCCTGCGCTGTGCCATGACCAGTCTGATTCCGGTGGGCCCGATTATGTGGTTCCGTGGTGCAGGTGCCGGTCGTGAACTGATCTATAATCAGAAAGAAGGCCACTTCCCGCGTGTGACCACCGTTAGTGAACTGACCAAACGTAATAATCTGGACTTCAGCATTAGTATTAGTAATATTACCCCGGCCGATGCAGGTACCTATTATTGTGTTAAATTCCGCAAAGGTAGCCCGGATGATGTTGAATTCAAAAGTGGTGCCGGTACCGAACTGAGCGTTCGTGCCAAACCGAGCGCCCCGGTGGTTAGCGGTCCGGCAGTTCGTGCCACCCCGGAACATACCGTTAGCTTCACCTGCGAAAGCCATGGCTTCAGTCCGCGTGATATTACCCTGAAATGGTTCAAAAATGGTAATGAACTGAGTGACTTCCAGACCAATGTGGATCCGGCAGGTGATAGTGTTAGCTATAGCATTCATAGCACCGCCCGTGTGGTTCTGACCCGTGGCGATGTTCATAGCCAGGTTATCTGTGAAATTGCCCATATTACCCTGCAGGGTGATCCGCTGCGCGGTACCGCAAATCTGAGTGAAGCAATTCGTGTGCCGCCGACCCTGGAAGTTACCCAGCAGCCGATGCGTGCCGAAAATCAGGCAAATGTTACCTGTCAGGTGAGTAACTTCTATCCGCGCGGCCTGCAGCTGACCTGGCTGGAAAATGGTAATGTTAGCCGCACCGAAACCGCCAGCACCCTGATTGAAAATAAAGATGGCACCTATAATTGGATGAGTTGGCTGCTGGTGAATACCTGTGCCCATCGTGATGATGTGGTGCTGACCTGTCAGGTTGAACATGATGGCCAGCAGGCCGTGAGTAAAAGTTATGCCCTGGAAATTAGCGCACATCAGAAAGAACATGGTAGCGATATTACCCATGAAGCCGCACTGGCACCGACCGCACCGCTG

Restriction Sites: NdeI-XhoI

Background: SIRPs (signal-regulatory proteins) are a family of transmembrane glycoproteins that were identified by their association with the Src homology 2 domaincontaining protein-tyrosine phosphatase SHP-2 in response to Insulin. The SIRP family negatively regulates the PI 3-K pathway, which may diminish EGFR-mediated motility and survival phenotypes that contribute to transformation of certain cell types. SIRP-α1 is a transmembrane protein which contains an extracellular portion with three immunoglobulin-like structures and a cytoplasmic region with four potential tyrosine phosphorylation sites. SIRP-α1 is a substrate for activated receptor tyrosine kinases. In its tyrosine phosphorylated form, SIRP-α1 binds to SH-PTP2 through SH2 interactions and acts as an SH-PTP2 substrate. SIRP-α1 has been shown to have negative regulatory effects on cellular responses induced by growth factors, oncogenes and insulin. SIRP-β1 shares extensive sequence homology with SIRP-α1 in its extracellular portion but lacks the cytoplasmic portion. SIRP-γ, originally designated SIRP-β2 (SIRP-B2, CD172g) has unique characteristics from both the α and β versions. SIRP-γ is expressed on the majority of T cells and a proportion of B cells. CD47 associates with SIRP-γ, and this interaction signals unidirectionally only.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~43kDa

Notes: For research use only, not for use in diagnostic procedure.

View full details