Product Description

CD178 Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0183-500, NCP0183-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: Association of the receptor Fas with its ligand FasL triggers an apoptotic pathway that plays an important role in immune regμlation, development, and progression of cancers. Loss of function mutation in either Fas (lpr mice) or FasL (gld mice) leads to lymphadenopathy and splenomegaly as a resμlt of decreased apoptosis in CD4-CD8- T lymphocytes. FasL (CD95L, Apo-1L) is a type II transmembrane protein of 280 amino acids (runs at approximately 40 kDa upon glycosylation) that belongs to the TNF family, which also includes TNF-α, TRAIL, and TWEAK. Binding of FasL to its receptor triggers the formation of a death-inducing signaling complex (DISC) involving the recruitment of the adaptor protein FADD and caspase-8. Activation of caspase-8 from this complex initiates a caspase cascade resμlting in the activation of caspase-3 and subsequent cleavage of proteins leading to apoptosis. Unlike Fas, which is constitutively expressed by various cell types, FasL is predominantly expressed on activated T lymphocytes, NK cells, and at immune privileged sites. FasL is also expressed in several tumor types as a mechanism to evade immune surveillance. Similar to other members of the TNF family, FasL can be cleaved by metalloproteinases producing a 26 kDa trimeric soluble form.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~20kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: P48023

Tag: His-tag

Amino Acid Sequence: CAGCTGTTCCATCTGCAGAAAGAACTGGCAGAACTGCGTGAAAGTACCAGCCAGATGCATACCGCAAGCAGTCTGGAAAAACAGATTGGCCATCCGAGCCCGCCGCCGGAAAAAAAAGAACTGCGCAAAGTTGCCCATCTGACCGGCAAAAGTAATAGTCGCAGTATGCCGCTGGAATGGGAAGATACCTATGGCATTGTGCTGCTGAGCGGTGTGAAATATAAAAAAGGCGGCCTGGTTATTAATGAAACCGGCCTGTACTTCGTGTATAGTAAAGTGTACTTCCGTGGTCAGAGCTGCAATAATCTGCCGCTGAGTCATAAAGTGTATATGCGTAATAGTAAGTACCCGCAGGATCTGGTTATGATGGAAGGTAAAATGATGAGTTATTGTACCACCGGTCAGATGTGGGCCCGCAGTAGCTATCTGGGTGCCGTGTTCAATCTGACCAGTGCCGATCATCTGTATGTGAATGTTAGCGAACTGAGCCTGGTTAACTTCGAAGAAAGCCAGACCTTCTTCGGCCTGTATAAACTG

Expression Vector: pet-22b(+)

Research Use Only