Product Description

CD1C Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0187-500, NCP0187-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: The CD1 mμltigene family encodes five forms of the CD1 T-cell surface glycoprotein in human, designated CD1A, 1B, 1C, 1D and 1E. CD1, a type 1 membrane protein, has structural similarity to the MHC class I antigen and has been shown to present lipid antigens for recognition by T lymphocytes. CD1 antigens are associated with β-2-Microglobμlin and expressed on cortical thymocytes, Langerhans cells, a B cell subset and some dendritic cells. Specifically, CD1A is a marker for Langerhans cell histiocytosis (LCH) and is found on interdigitating cells. Adaptor-protein complexes and CD1-associated chaperones control CD1 trafficking, and the development and activation of CD1-restricted T cells. Constitutive endocytosis of CD1B molecμles and the differential sorting of MHC class II from lysosomes separate peptide- and lipid antigen-presenting molecμles during dendritic cell maturation. CD1B is also expressed in interdigitating cells. The human CD1 genes are all closely linked in a cluster mapping at chromosome 1q23.1.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~31kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: P29017

Tag: His-tag

Amino Acid Sequence: AACGCCGATGCCAGTCAGGAACATGTGAGCTTCCATGTTATTCAGATCTTCAGCTTCGTTAATCAGAGCTGGGCACGTGGTCAGGGTAGCGGTTGGCTGGATGAACTGCAGACCCATGGCTGGGATAGTGAAAGCGGCACCATTATCTTCCTGCATAATTGGAGCAAAGGTAACTTCAGTAATGAAGAACTGAGTGATCTGGAACTGCTGTTCCGCTTCTATCTGTTCGGCCTGACCCGCGAAATTCAGGATCATGCCAGTCAGGATTATAGCAAATATCCGTTCGAAGTTCAGGTTAAAGCCGGCTGCGAACTGCATAGCGGTAAAAGCCCGGAAGGCTTCTTCCAGGTTGCATTCAATGGCCTGGATCTGCTGAGCTTCCAGAATACCACCTGGGTTCCGAGTCCGGGTTGTGGCAGTCTGGCACAGAGCGTGTGTCATCTGCTGAATCATCAGTATGAAGGTGTTACCGAAACCGTGTATAATCTGATTCGTAGCACCTGCCCGCGCTTCCTGCTGGGTCTGCTGGATGCAGGCAAAATGTATGTGCATCGTCAGGTGCGCCCGGAAGCCTGGCTGAGTAGCCGCCCTAGCCTGGGCAGTGGCCAGCTGCTGCTGGTGTGTCATGCAAGTGGCTTCTATCCGAAACCGGTGTGGGTTACCTGGATGCGTAATGAACAGGAACAGCTGGGTACCAAACATGGCGATATTCTGCCGAATGCAGATGGTACCTGGTATCTGCAGGTTATTCTGGAAGTGGCCAGCGAAGAACCGGCCGGTCTGAGCTGTCGCGTGCGTCATAGCAGTCTGGGTGGCCAGGATATTATTCTGTATTGGGGTCATCACTTCAGCATG

Expression Vector: pet-22b(+)

Research Use Only