Bioworld
CD1D Recombinant Protein - NCP0188
CD1D Recombinant Protein - NCP0188
Couldn't load pickup availability
CD1D Recombinant Protein
Sizes: 500μg, 1mg
Catalogue Numbers: NCP0188-500, NCP0188-1000
Lead times: 1-2 weeks, if manufacturer has product in stock
Manufacturer/Ship Location: China
Background: The CD1 mμltigene family encodes five forms of the CD1 T cell surface glycoprotein in human, designated CD1A, 1B, 1C, 1D and 1E. CD1, a type 1 membrane protein, has structural similarity to the MHC class I antigen and has been shown to present lipid antigens for recognition by T lymphocytes. CD1 antigens are associated with β-2-Microglobμlin and expressed on cortical thymocytes, Langerhans cells, a B cell subset and some dendritic cells. Adaptor protein complexes and CD1-associated chaperones control CD1 trafficking and the development and activation of CD1-restricted T cells. CD1D is present on human intestinal epithelial cells (IEC) and exists as a β-2-Microglobμlinindependent nonglycosylated form or a β-2-Microglobμlin-dependent glycosylated form. The human CD1D gene maps to chromosome 1q23.1 and encodes a 335 amino acid protein that influences normal T cell maturation.
Category: Protein
Host: E. coli
Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).
Molecular Weight: ~31kDa
Solubility: PBS, 4M Urea, PH7.4
Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Restriction Sites: NdeI-XhoI
SwissProt: P15813
Tag: His-tag
Amino Acid Sequence: GAAGTGCCGCAGCGTCTGTTCCCGCTGCGCTGCCTGCAGATTAGCAGCTTCGCCAATAGCAGCTGGACCCGTACCGATGGTCTGGCCTGGCTGGGTGAACTGCAGACCCATAGTTGGAGTAATGATAGTGATACCGTGCGCAGTCTGAAACCGTGGAGCCAGGGCACCTTCAGTGATCAGCAGTGGGAAACCTTACAGCATATCTTCCGTGTGTATCGTAGCAGCTTCACCCGTGATGTTAAAGAATTCGCAAAAATGCTGCGTCTGAGCTATCCGCTGGAACTGCAGGTTAGCGCAGGTTGCGAAGTTCATCCGGGCAATGCAAGCAATAACTTCTTCCATGTGGCATTCCAGGGCAAAGATATTCTGAGCTTCCAGGGCACCAGCTGGGAACCGACCCAGGAAGCACCGCTGTGGGTTAATCTGGCAATTCAGGTTCTGAATCAGGATAAATGGACCCGCGAAACCGTGCAGTGGCTGCTGAATGGTACCTGCCCGCAGTTCGTGAGCGGCCTGCTGGAAAGTGGCAAAAGTGAACTGAAAAAACAGGTTAAACCGAAAGCCTGGCTGAGCCGCGGTCCGAGTCCGGGTCCTGGTCGTCTGCTGCTGGTGTGTCATGTGAGTGGCTTCTATCCGAAACCGGTGTGGGTTAAATGGATGCGTGGTGAACAGGAACAGCAGGGCACCCAGCCGGGTGATATTCTGCCGAATGCAGATGAAACCTGGTATCTGCGTGCAACCCTGGATGTTGTTGCAGGCGAAGCCGCAGGTCTGAGCTGCCGTGTTAAACATAGTAGCCTGGAAGGTCAGGATATTGTTCTGTATTGGGGTGGCAGTTATACCAGT
Expression Vector: pet-22b(+)
Research Use Only
