Skip to product information
1 of 1

Bioworld

CD1E Recombinant Protein - NCP0189

CD1E Recombinant Protein - NCP0189

Regular price $1,152.00 CAD
Regular price Sale price $1,152.00 CAD
Sale Sold out
Size
Quantity

Get a quote

CD1E Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0189-500, NCP0189-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: The human CD1 family consists of five chromosome 1-localized genes which encode proteins that are involved in mediating the presentation of lipid antigens of microbial or self origin on the surface of immune cells. CD1E, also known as R2 or CD1A, is a 322 amino acid single-pass type I membrane protein that localizes to the lumen of the endoplasmic reticμlum, as well as to the Golgi apparatus and contains one Ig-like domain. Expressed in a variety of tissues and on cortical thymocytes, dendritic cells and Langerhans cells, CD1E exists as a heterodimer with β-2-microglobμlin and is necessary for the presentation of glycolipid antigens on the cell surface. CD1E is subject to posttranslational mono-ubiquitination and may also be proteolytically cleaved in endosomes to yield a soluble protein. CD1E is present on the surface of some T cell leukemias, suggesting a possible role in tumorigenesis.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~30kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: P15812

Tag: His-tag

Amino Acid Sequence: GAAGAACAGCTGAGCTTCCGTATGCTGCAGACCAGTAGCTTCGCAAATCATAGCTGGGCACATAGTGAAGGCAGCGGTTGGCTGGGCGATCTGCAGACCCATGGTTGGGATACCGTGCTGGGTACCATTCGCTTCCTGAAACCGTGGAGCCATGGCAACTTCAGTAAACAGGAACTGAAAAATCTGCAGAGTCTGTTCCAGCTGTACTTCCATAGCTTCATTCAGATTGTGCAGGCCAGTGCAGGCCAGTTCCAGCTGGAATATCCGTTCGAAATTCAGATTCTGGCAGGCTGTCGTATGAATGCCCCGCAGATCTTCCTGAATATGGCATATCAGGGTAGCGACTTCCTGAGCTTCCAGGGCATTAGCTGGGAACCGAGCCCGGGTGCAGGCATTCGCGCACAGAATATCTGTAAAGTGCTGAATCGTTATCTGGATATTAAAGAAATCCTGCAGAGCCTGCTGGGTCATACCTGTCCGCGCTTCCTGGCAGGTCTGATGGAAGCAGGTGAAAGCGAACTGAAACGTAAAGTGAAACCGGAAGCATGGCTGAGTTGCGGTCCGAGTCCGGGTCCGGGCCGTCTTCAGCTGGTGTGTCATGTGAGTGGCTTCTATCCGAAACCGGTGTGGGTGATGTGGATGCGTGGTGAACAGGAACAGCGCGGCACCCAGCGCGGCGATGTTCTGCCTAATGCAGATGAAACCTGGTATCTGCGTGCCACCCTGGATGTTGCCGCAGGCGAAGCAGCCGGTCTGAGCTGTCGTGTGAAACATAGCAGTCTGGGTGGTCATGATCTGATTATTCATTGGGGTGGTTAT

Expression Vector: pet-22b(+)

Research Use Only

View full details