Skip to product information
1 of 1

Bioworld

CD226/DNAM-1 Recombinant Protein - NCP0192

CD226/DNAM-1 Recombinant Protein - NCP0192

Regular price $1,152.00 CAD
Regular price Sale price $1,152.00 CAD
Sale Sold out
Size
Quantity

Get a quote

CD226/DNAM-1 Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0192-500, NCP0192-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: DNAM-1/CD226 is a member of the immunoglobμlin-like superfamily. It is expressed on T cells, natural killer (NK) cells, monocytes, and macrophages. It is a major activating receptor on NK cells. Engagement with its ligands Nectin-2 (CD112) and PVR (poliovirus receptor, also known as CD155) on the target cells leads to downstream activation of ERK, AKT, and PLCg2 signaling pathways that are crucial for NK activation and NK-mediated killing. LFA-1 physically associates with DNAM-1/CD226 and contributes to its signaling. Activating signal of DNAM-1/CD226 is counterbalanced by inhibitory receptors TIGIT and CD96, competing for the common ligands CD122 and PVR.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~26kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: Q15762

Tag: His-tag

Amino Acid Sequence: GAAGAAGTTCTGTGGCATACCAGTGTTCCGTTCGCAGAAAATATGAGTCTGGAATGCGTGTATCCGAGTATGGGTATTCTGACCCAGGTGGAATGGTTCAAAATTGGTACCCAGCAGGATAGCATTGCAATCTTCAGTCCGACCCATGGTATGGTGATTCGCAAACCGTATGCAGAACGTGTGTACTTCCTGAATAGCACCATGGCCAGCAATAATATGACCCTGTTCTTCCGCAATGCCAGTGAAGATGATGTTGGCTATTATAGCTGTAGCCTGTATACCTATCCGCAGGGCACCTGGCAGAAAGTGATTCAGGTGGTTCAGAGTGATAGCTTCGAAGCAGCAGTTCCGAGCAATAGCCATATTGTGAGCGAACCGGGTAAAAATGTGACCCTGACCTGTCAGCCGCAGATGACCTGGCCGGTGCAGGCAGTTCGCTGGGAAAAAATTCAGCCGCGCCAGATTGATCTGCTGACCTATTGCAATCTGGTGCATGGCCGTAACTTCACCAGTAAATTCCCGCGTCAGATTGTGAGTAATTGTAGTCATGGCCGTTGGAGCGTTATTGTGATTCCGGATGTGACCGTTAGCGATAGTGGCCTGTATCGCTGTTATCTGCAGGCAAGCGCAGGCGAAAATGAAACCTTCGTGATGCGCCTGACCGTTGCAGAAGGTAAAACCGATAATCAGTATACCCTGTTCGTGGCA

Expression Vector: pet-22b(+)

Research Use Only

View full details