Skip to product information
1 of 1

Bioworld

CD253 Recombinant Protein - NCP0194

CD253 Recombinant Protein - NCP0194

Regular price $1,152.00 CAD
Regular price Sale price $1,152.00 CAD
Sale Sold out
Size
Quantity

Get a quote

CD253 Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0194-500, NCP0194-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: Tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL), also referred to as Apo2 ligand, first identified based on its sequence homology to TNF and Fas/Apo ligand is a member of the TNF family of cytokines and either exists as a type II membrane or soluble protein. TRAIL induces apoptosis in a variety of transformed cell lines and plays a role in anti-tumor and anti-viral immune surveillance. TRAIL signals via binding with death receptors DR4 (TRAIL-R1) and DR5 (TRAIL-R2) which can trigger apoptosis as well as NF-κB activation. Death domains on these receptors leads to the recruitment of a death-induced signaling complex (DISC) leading to caspase-8 and subsequent caspase-3 activation. In addition, TRAIL binds with decoy receptors DcR1 (TRAIL-R3) and DcR2 (TRAIL-R4, TRUNDD) which lack the functional cytoplasmic death domain antagonizing TRAIL-induced apoptosis. Osteoprotegerin (OPG) has also been identified as receptor capable of inhibiting TRAIL-induced apoptosis. The selectivity of soluble TRAIL at triggering apoptosis in transformed cells as compared to normal cells has led to its investigation as a potential cancer therapeutic.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~27kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: P50591

Tag: His-tag

Amino Acid Sequence: ACCAATGAACTGAAACAGATGCAGGATAAATATAGTAAAAGCGGTATTGCCTGCTTCCTGAAAGAAGATGATAGTTATTGGGATCCGAATGATGAAGAAAGCATGAATAGTCCGTGCTGGCAGGTGAAATGGCAGCTGCGTCAGCTGGTGCGCAAAATGATTCTGCGTACCAGCGAAGAAACCATTAGCACCGTGCAGGAAAAACAGCAGAATATTAGTCCGCTGGTTCGCGAACGCGGCCCGCAGAGAGTGGCAGCTCATATTACCGGCACCCGTGGCCGCAGTAATACCCTGAGCAGCCCGAATAGTAAAAATGAAAAAGCCCTGGGCCGCAAAATTAATAGCTGGGAAAGCAGCCGCAGTGGTCATAGCTTCCTGAGTAATCTGCATCTGCGTAATGGCGAACTGGTTATTCATGAAAAAGGCTTCTATTATATCTACAGCCAGACCTACTTCCGCTTCCAGGAAGAAATTAAAGAAAATACCAAGAACGACAAGCAGATGGTGCAGTATATCTATAAATATACCAGCTATCCGGATCCGATTCTGCTGATGAAAAGCGCCCGTAATAGTTGCTGGAGCAAAGATGCAGAATATGGTCTGTATAGTATCTATCAGGGTGGCATCTTCGAACTGAAAGAAAATGATCGTATCTTCGTGAGCGTGACCAATGAACATCTGATTGATATGGATCATGAAGCCAGCTTCTTCGGTGCATTCCTGGTTGGT

Expression Vector: pet-22b(+)

Research Use Only

View full details