Product Description

CD262 Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0195-500, NCP0195-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: The tumor necrosis factor receptor family, which includes TNF-RI, Fas, DR3, DR4, DR5, and DR6, plays an important role in the regμlation of apoptosis in various physiological systems. The receptors are activated by a family of cytokines that include TNF, FasL, and TNF-related apoptosis-inducing ligand (TRAIL). They are characterized by a highly conserved extracellμlar region containing cysteine-rich repeats and a conserved intracellμlar region of about 80 amino acids termed the death domain (DD). The DD is important for transducing the death signal by recruiting other DD containing adaptor proteins (FADD, TRADD, RIP) to the death-inducing signaling complex (DISC), resμlting in activation of caspases. DR5 is a receptor for TNF-related apoptosis inducing ligand (TRAIL), which has been shown to induce apoptosis in a variety of cell types and has been targeted for cancer therapy. Structurally, DR5 contains an amino-terminal leader cleavage site, followed by an extracellμlar region containing two cysteine-rich repeats, a central transmembrane domain, and a carboxy-terminal DD. DR5 is expressed in a wide variety of tissues and is a transcriptional target of p53. It induces apoptosis through a FADD-dependent pathway. Deletion of DR5 leads to resistance in TRAIL-mediated apoptosis as well as an abrogated response to DNA-damaging stimμli. At least two isoforms of DR5 are produced by alternative splicing.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~24kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: O14763

Tag: His-tag

Amino Acid Sequence: ATCACCCAGCAGGATCTGGCACCGCAGCAGCGCGCAGCCCCTCAACAGAAACGTAGTAGCCCGAGCGAAGGTCTGTGCCCGCCGGGTCATCATATTAGCGAAGATGGCCGTGATTGCATTAGCTGCAAATATGGTCAGGATTATAGTACCCATTGGAATGATCTGCTGTTCTGTCTGCGTTGTACCCGCTGTGATAGTGGTGAAGTTGAACTGAGTCCGTGTACCACCACCCGTAATACCGTGTGCCAGTGCGAAGAAGGCACCTTCCGCGAAGAAGATAGCCCGGAAATGTGCCGCAAATGCCGTACCGGCTGCCCGCGCGGTATGGTTAAAGTTGGTGATTGTACCCCGTGGAGTGATATTGAATGCGTTCATAAAGAAAGTGGTACCAAACATAGCGGCGAAGTGCCGGCAGTGGAAGAAACCGTTACCAGCAGCCCGGGCACCCCGGCTAGCCCTTGTAGC

Expression Vector: pet-22b(+)

Research Use Only