BioWorld
CD27 Recombinant Protein - NCP0196
CD27 Recombinant Protein - NCP0196
Couldn't load pickup availability
CD27 Recombinant Protein
Catalogue Number: NCP0196-500, NCP0196-1000
Sizes: 500ug, 1mg
Swiss-Prot: P26842
Host: E.coli
Tag: His-tag
AA Sequence: GCTACCCCTGCACCGAAAAGCTGCCCGGAACGTCATTATTGGGCCCAGGGCAAACTGTGCTGTCAGATGTGCGAACCGGGTACCTTCCTGGTGAAAGATTGTGATCAGCATCGCAAAGCAGCCCAGTGCGATCCGTGTATTCCGGGTGTTAGCTTCAGCCCGGATCATCATACCCGCCCGCATTGCGAAAGTTGTCGCCATTGTAATAGCGGTCTGCTGGTTCGTAATTGCACCATTACCGCAAATGCAGAATGTGCATGTCGCAATGGCTGGCAGTGTCGTGATAAAGAATGCACCGAATGCGATCCGCTGCCGAATCCGAGTCTGACCGCCCGTAGCAGCCAGGCACTGAGTCCGCATCCGCAGCCGACCCATCTGCCGTATGTTAGCGAAATGCTGGAAGCACGCACCGCCGGTCACATGCAGACCCTGGCCGACTTCCGCCAGCTGCCGGCACGTACCCTGAGCACCCATTGGCCGCCGCAGCGTAGTCTGTGCAGTAGTGACTTCATTCGC
Restriction Sites: NdeI-XhoI
Background: CD27 (TNFRSF7) is a transmemebrane protein of the TNF receptor superfamily (TNFRSF). It is mainly expressed on lymphoid cells (also on early hematopoietic precursor cells in mice). CD27 is considered a phenotypic marker for memory B cells and is also used to identify B regulatory (Breg) cells. It is constitutively expressed on naïve CD4 and CD8 T cells and its expression is further upregulated upon T cell activation. CD27 is one of the two most important co-stimulatory receptors for T cell priming (the other one is CD28). While CD28 co-stimulatory signal mainly triggers cell proliferation, CD27 co-stimulatory signal primarily promotes cell survival and differentiation. Upon binding to its ligand CD70, CD27 activates the NF-κB and JNK signaling pathways through TNFR associated factors (TRAFs), the adaptor molecules that are associated with CD27 cytoplasmic tail domain. Upon activation CD27 is shed from cell surface and soluble CD27 is used as a marker of T cell activation.
Soluble: PBS, 4M Urea, PH7.4
Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).
Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Expression Vector: pet-22b(+)
BioWorld Molecular Weight: ~22kDa
Notes: For research use only, not for use in diagnostic procedure.