Product Description

CD302 Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0198-500, NCP0198-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: CD302，potential mμltifunctional C-type lectin receptor that may play roles in endocytosis and phagocytosis as well as in cell adhesion and migration.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~17kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: Q8IX05

Tag: His-tag

Amino Acid Sequence: GATTGCCCGAGTAGTACCTGGATTCAGTTCCAGGATAGCTGTTATATCTTCCTGCAGGAAGCCATTAAAGTTGAAAGCATTGAAGATGTGCGTAATCAGTGCACCGATCATGGCGCCGATATGATTAGTATTCATAATGAAGAAGAGAACGCATTCATTCTGGATACCCTGAAAAAACAGTGGAAAGGTCCGGATGATATTCTGCTGGGTATGTTCTATGATACCGATGATGCCAGCTTCAAATGGTTCGATAATAGTAATATGACCTTCGATAAGTGGACCGATCAGGATGATGATGAAGATCTGGTGGATACCTGCGCATTCCTGCATATTAAAACCGGCGAATGGAAAAAAGGTAATTGCGAAGTTAGTAGCGTGGAAGGTACCCTGTGTAAAACCGCAATTCCGTATAAACGCAAATATCTGAGCGATAATCAT

Expression Vector: pet-22b(+)

Research Use Only