Product Description

CD32 (FcgammaRIIb) Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0200-500, NCP0200-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: FcγRIIB (CD32B) is a low affinity, IgG Fc-binding receptor expressed on B cells, monocytes, macrophages, and dendritic cells (DCs). It is the inhibitory Fc receptor and signals through an immunoreceptor tyrosine-based inhibitory motif (ITIM) within its carboxy-terminal cytoplasmic tail. Binding of immune complexes to FcγRIIB resμlts in tyrosine phosphorylation of the ITIM motif at Tyr292 and recruitment of the phosphatase SHIP, which mediates inhibitory effects on immune cell activation. In this way, FcγRIIB suppresses the effects of activating Fc-binding receptors. For example, mice deficient for FcγRIIB have greater T cell and DC responses following injection of immune complexes . In addition, FcγRIIB plays a role in B cell affinity maturation. Signaling through FcγRIIB in the absence of signaling through the B cell receptor (BCR) is proapoptotic, while signaling through FcγRIIB and the BCR simμltaneously attenuates the apoptotic signal and resμlts in selection of B cells with higher antigen affinity.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~23kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: P31994

Tag: His-tag

Amino Acid Sequence: ACCCCTGCTGCACCGCCTAAAGCAGTGCTGAAACTGGAACCGCAGTGGATTAATGTTCTGCAGGAAGATAGTGTGACCCTGACCTGCCGCGGCACCCATAGTCCGGAAAGTGATAGTATTCAGTGGTTCCATAATGGCAATCTGATTCCGACCCATACCCAGCCGAGTTATCGCTTCAAAGCCAATAATAATGATAGTGGCGAATATACCTGCCAGACCGGTCAGACCAGCCTGAGCGATCCGGTGCATCTGACCGTTCTGAGCGAATGGCTGGTTCTGCAGACCCCGCATCTGGAATTCCAGGAAGGTGAAACCATTGTGCTGCGCTGTCATAGCTGGAAAGATAAACCGCTGGTTAAAGTTACCTTCTTCCAGAATGGTAAAAGTAAAAAATTCAGCCGCAGCGATCCGAACTTCAGCATTCCGCAGGCCAATCATAGTCATAGCGGCGATTATCATTGCACCGGTAATATTGGTTATACCCTGTATAGCAGTAAACCGGTGACCATTACCGTGCAGGCCCCG

Expression Vector: pet-22b(+)

Research Use Only