Product Description

CD320 Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0201-500, NCP0201-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: The 8D6 protein, also known as 8D6A, CD320 or FDC-SM-8D6, is a single pass, type I membrane protein with two low-density lipoprotein receptor
ligand binding repeats (LDL-A modμles). It is expressed by follicμlar dendritic cells in the germinal center and acts as a stimμlatory signaling molecμle. Follicμlar dendritic cells and T cells interact with germinal center B cells, providing signals for survival, proliferation and differentiation into memory B cells and plasma cells. A disruption of this interaction resμlts in apoptosis of B cells. 8D6 is a growth factor required for plasma cell generation from germinal center B cells. Protein 8D6, together with HCAM (or CD44), plays a significant role in the proliferation of lymphoma cells of germinal center origin. 8D6 is responsible for enhancing proliferation while HCAM inhibits apoptosis.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~27kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: Q9NPF0

Tag: His-tag

Amino Acid Sequence: AGTCCGCTGAGTACCCCGACCAGCGCCCAGGCAGCCGGTCCTAGTAGCGGCAGCTGTCCGCCGACCAAATTCCAGTGCCGTACCAGTGGTCTGTGTGTTCCGCTGACCTGGCGTTGCGATCGTGATCTGGATTGCAGCGATGGCAGCGATGAAGAAGAATGCCGTATTGAACCGTGTACCCAGAAAGGCCAGTGCCCGCCGCCGCCTGGTCTGCCTTGTCCTTGCACCGGCGTTAGTGATTGTAGCGGCGGCACCGATAAAAAACTGCGCAATTGCAGCCGTCTGGCCTGTCTGGCAGGTGAACTGCGTTGCACCCTGAGTGATGATTGCATTCCGCTGACCTGGCGCTGTGATGGTCATCCGGATTGCCCGGATAGTAGCGATGAACTGGGTTGTGGCACCAATGAAATTCTGCCGGAAGGTGATGCCACCACCATGGGTCCGCCGGTTACCCTGGAAAGCGTGACCAGCCTGCGCAATGCAACCACCATGGGCCCGCCGGTTACACTGGAAAGCGTTCCGAGCGTTGGTAATGCAACCAGCAGTAGCGCCGGCGATCAGAGTGGCAGTCCGACCGCATAT

Expression Vector: pet-22b(+)

Research Use Only