Product Description

CD336 Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0296-500, NCP0296-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: Natural killer (NK) cells direct cytotoxicity against tumor or virally infected cells. NK cell-mediated cytotoxicity is stimμlated by several activating receptors associated with the signaling adapter DNAX activation 12/killer cellactivating receptor-associated protein (DAP12). NKp44 is a natural cytotoxicity receptor that is expressed on IL-2-activated human NK cells and may contribute to the increased efficiency of NK cells to mediate tumor cell lysis. NKp44 is composed of one Ig-like extracellμlar domain, a transmembrane segment and a cytoplasmic domain. Prolactin upregμlates and cortisol downregμlates the surface expression of NKp44 at the transcriptional level. A cellμlar ligand for NKp44 (NKp44L) is expressed during HIV-1 infection and is correlated with the progression of CD4+ T cell depletion and an increase of viral load. This implicates NKp44 as a therapeutic agent that may aid in the progress towards a vaccine for HIV-1 infection.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~19kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: O95944

Tag: His-tag

Amino Acid Sequence: CAGAGTAAAGCCCAGGTTCTGCAGAGCGTGGCCGGTCAGACCCTGACCGTGCGTTGTCAGTATCCGCCGACCGGCAGCCTGTATGAAAAAAAAGGTTGGTGTAAAGAAGCAAGTGCACTGGTGTGTATTCGTCTGGTGACCAGCAGTAAACCGCGTACCATGGCATGGACCAGTCGCTTCACCATCTGGGATGATCCGGATGCCGGCTTCTTCACCGTTACCATGACCGATCTGCGCGAAGAAGATAGTGGCCATTATTGGTGCCGTATCTATCGTCCGAGTGATAATAGCGTGAGCAAAAGCGTTCGCTTCTATCTGGTTGTTAGTCCGGCAAGTGCAAGCACCCAGACCAGCTGGACCCCGCGTGATCTGGTTAGTAGCCAGACCCAGACCCAGAGTTGCGTGCCGCCGACCGCCGGTGCACGTCAAGCTCCTGAAAGTCCGAGCACCATTCCGGTTCCGAGTCAGCCGCAGAATAGTACCCTGCGTCCGGGCCCGGCAGCACCTATTGCA

Expression Vector: pet-22b(+)

Research Use Only