Product Description

CD337 Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0297-500, NCP0297-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: The immune response is the way the body recognizes and defends itself against microorganisms, viruses and substances recognized as foreign and potentially harmfμl to the body. Innate immunity is the barrier that keeps foreign materials from entering the body and represents the first line of defense in the immune response. During the innate response to many inflammatory and infectious stimμli, dendritic cells (DCs) undergo a differentiation process termed maturation. Mature DCs activate antigen-specific naive T
cells and resting human natural killer (NK) cells. NK cell receptors NKp30, NKp44 and NKp46 appear to play prominent roles in NK cell activation. The human NKp30 gene maps to chromosome 6p21.3 and encodes a 190 amino acid protein. The NKp30 protein contains a signal peptide followed by a 120 amino acid extracellμlar region that forms a V-type Ig-like domain with 2 potential N-linked glycosylation sites, a hydrophobic transmembrane region with a positively charged Arginine residue, and a 33 amino acid cytoplasmic
tail lacking an immunoreceptor tyrosine-based activating motif (ITAM). NKp30 cooperates with NKp46 and/or NKp44 in the induction of NK-mediated cytotoxicity against the majority of target cells, where it represents the major triggering receptor in the killing of certain tumors.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~14kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: O14931

Tag: His-tag

Amino Acid Sequence: CTGTGGGTTAGCCAGCCGCCGGAAATTCGCACCCTGGAAGGCAGTAGTGCCTTCCTGCCGTGTAGCTTCAATGCAAGCCAGGGCCGCCTGGCCATTGGCAGTGTGACCTGGTTCCGTGATGAAGTTGTTCCGGGTAAAGAAGTTCGCAATGGTACCCCGGAATTCCGTGGCCGCCTGGCACCGCTGGCAAGTAGCCGCTTCCTGCATGATCATCAGGCAGAACTGCATATTCGTGATGTTCGTGGCCATGATGCAAGCATCTATGTGTGTCGCGTTGAAGTTCTGGGCCTGGGTGTTGGTACCGGTAATGGCACCCGCCTGGTTGTTGAAAAAGAACATCCGCAGCTGGGT

Expression Vector: pet-22b(+)

Research Use Only