Product Description

CD349 Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0300-500, NCP0300-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: Receptor for WNT2 that is coupled to the beta-catenin canonical signaling pathway, which leads to the activation of disheveled proteins, inhibition of GSK-3 kinase, nuclear accumμlation of beta-catenin and activation of Wnt target genes. Plays a role in neuromuscμlar junction (NMJ) assembly by negatively regμlating the clustering of acetylcholine receptors (AChR) through the beta-catenin canonical signaling pathway. May play a role in neural progenitor cells (NPCs) viability through the beta-catenin canonical signaling pathway by negatively regμlating cell cycle arrest leading to inhibition of neuron apoptotic process.

During hippocampal development, regμlates neuroblast proliferation and apoptotic cell death. Controls bone formation through non canonical Wnt signaling mediated via ISG15. Positively regμlates bone regeneration through non canonical Wnt signaling (By similarity).

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~28kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: O00144

Tag: His-tag

Amino Acid Sequence: CTGGAAATTGGTCGCTTCGATCCGGAACGTGGCCGTGGTGCCGCCCCTTGTCAGGCAGTTGAAATTCCGATGTGCCGTGGTATTGGTTATAATCTGACCCGCATGCCGAATCTGCTGGGCCATACCAGTCAGGGCGAAGCAGCCGCCGAACTGGCAGAATTCGCCCCGCTGGTTCAGTATGGTTGCCATAGCCATCTGCGCTTCTTCCTGTGTAGCCTGTATGCCCCGATGTGCACCGATCAGGTTAGCACCCCGATTCCGGCATGTCGCCCGATGTGCGAACAGGCACGCCTGCGCTGTGCACCGATTATGGAACAGTTCAACTTCGGTTGGCCGGATAGTCTGGATTGTGCCCGCCTGCCGACCCGCAATGATCCGCATGCACTGTGCATGGAAGCACCGGAAAATGCCACCGCCGGCCCGGCTGAACCGCATAAAGGTCTGGGCATGCTGCCGGTGGCACCGCGTCCTGCACGTCCTCCTGGTGATCTGGGTCCGGGTGCAGGTGGTAGTGGCACCTGTGAAAATCCGGAAAAATTCCAGTATGTGGAAAAAAGCCGTAGCTGTGCACCGCGCTGCGGCCCTGGTGTGGAAGTGTTCTGGAGCCGCCGTGATAAAGAT

Expression Vector: pet-22b(+)

Research Use Only