Product Description

CD349 Recombinant Protein

Catalogue Number: NCP0300-500, NCP0300-1000

Sizes: 500ug, 1mg

Swiss-Prot: O00144

Host: E.coli

Tag: His-tag

AA Sequence: CTGGAAATTGGTCGCTTCGATCCGGAACGTGGCCGTGGTGCCGCCCCTTGTCAGGCAGTTGAAATTCCGATGTGCCGTGGTATTGGTTATAATCTGACCCGCATGCCGAATCTGCTGGGCCATACCAGTCAGGGCGAAGCAGCCGCCGAACTGGCAGAATTCGCCCCGCTGGTTCAGTATGGTTGCCATAGCCATCTGCGCTTCTTCCTGTGTAGCCTGTATGCCCCGATGTGCACCGATCAGGTTAGCACCCCGATTCCGGCATGTCGCCCGATGTGCGAACAGGCACGCCTGCGCTGTGCACCGATTATGGAACAGTTCAACTTCGGTTGGCCGGATAGTCTGGATTGTGCCCGCCTGCCGACCCGCAATGATCCGCATGCACTGTGCATGGAAGCACCGGAAAATGCCACCGCCGGCCCGGCTGAACCGCATAAAGGTCTGGGCATGCTGCCGGTGGCACCGCGTCCTGCACGTCCTCCTGGTGATCTGGGTCCGGGTGCAGGTGGTAGTGGCACCTGTGAAAATCCGGAAAAATTCCAGTATGTGGAAAAAAGCCGTAGCTGTGCACCGCGCTGCGGCCCTGGTGTGGAAGTGTTCTGGAGCCGCCGTGATAAAGAT

Restriction Sites: NdeI-XhoI

Background: Receptor for WNT2 that is coupled to the beta-catenin canonical signaling pathway, which leads to the activation of disheveled proteins, inhibition of GSK-3 kinase, nuclear accumulation of beta-catenin and activation of Wnt target genes. Plays a role in neuromuscular junction (NMJ) assembly by negatively regulating the clustering of acetylcholine receptors (AChR) through the beta-catenin canonical signaling pathway. May play a role in neural progenitor cells (NPCs) viability through the beta-catenin canonical signaling pathway by negatively regulating cell cycle arrest leading to inhibition of neuron apoptotic process.

During hippocampal development, regulates neuroblast proliferation and apoptotic cell death. Controls bone formation through non canonical Wnt signaling mediated via ISG15. Positively regulates bone regeneration through non canonical Wnt signaling (By similarity).

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~28kDa

Notes: For research use only, not for use in diagnostic procedure.