Product Description

CD352 Recombinant Protein

Catalogue Number: NCP0302-500, NCP0302-1000

Sizes: 500ug, 1mg

Swiss-Prot: Q96DU3

Host: E.coli

Tag: His-tag

AA Sequence: CAGAGTAGTCTGACCCCGCTGATGGTTAATGGTATTCTGGGCGAAAGTGTTACCCTGCCGCTGGAATTCCCGGCAGGCGAAAAAGTTAACTTCATTACCTGGCTGTTCAATGAAACCAGTCTGGCATTCATTGTTCCGCATGAAACCAAAAGTCCGGAAATTCATGTTACCAATCCGAAACAGGGCAAACGCCTGAACTTCACCCAGAGTTATAGCCTGCAGCTGAGTAATCTGAAAATGGAAGATACCGGTAGTTATCGTGCCCAGATTAGTACCAAAACCAGTGCAAAACTGAGCAGCTATACCCTGCGCATTCTGCGCCAGCTGCGTAATATTCAGGTGACCAATCATAGCCAGCTGTTCCAGAATATGACCTGTGAACTGCATCTGACCTGCAGCGTGGAAGATGCAGATGATAATGTGAGCTTCCGTTGGGAAGCCCTGGGCAATACCCTGAGCAGCCAGCCGAATCTGACCGTGAGCTGGGATCCGCGCATTAGTAGCGAACAGGATTATACCTGTATTGCAGAAAATGCAGTTAGTAATCTGAGCTTCAGCGTTAGTGCACAGAAACTGTGTGAAGATGTTAAAATTCAGTACACCGATACCAAAATG

Restriction Sites: NdeI-XhoI

Background: SLAMF6 (CD352/NTB-A) is a type-I transmembrane glycoprotein belonging to the signaling lymphocytic activation molecule (SLAM) family of immunomodulatory receptors. Like other members of the SLAM receptor family, SLAMF6 contains Ig-like domains within its extracellular region and conserved tyrosine-based signaling motifs within its intracellular domain that, when phosphorylated, bind to the SAP and EAT-2 signaling adaptors. SLAMF6 is expressed on the surface of multiple types of immune cells, such as those of the B, T, and NK lineages. Its activation is triggered by homotypic interactions involving its extracellular domain. Indeed, research studies have shown that in T-cells, SLAMF6 engagement facilitates activation and cytokine production. Similarly, homotypic ligand-mediated engagement of SLAMF6 on NK cells activates signaling cascades that drive proliferation, cytotoxicity, and cytokine production.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~25kDa

Notes: For research use only, not for use in diagnostic procedure.