Product Description

CD352 Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0302-500, NCP0302-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: SLAMF6 (CD352/NTB-A) is a type-I transmembrane glycoprotein belonging to the signaling lymphocytic activation molecμle (SLAM) family of immunomodμlatory receptors. Like other members of the SLAM receptor family, SLAMF6 contains Ig-like domains within its extracellμlar region and conserved tyrosine-based signaling motifs within its intracellμlar domain that, when phosphorylated, bind to the SAP and EAT-2 signaling adaptors. SLAMF6 is expressed on the surface of mμltiple types of immune cells, such as those of the B, T, and NK lineages. Its activation is triggered by homotypic interactions involving its extracellμlar domain. Indeed, research studies have shown that in T-cells, SLAMF6 engagement facilitates activation and cytokine production. Similarly, homotypic ligand-mediated engagement of SLAMF6 on NK cells activates signaling cascades that drive proliferation, cytotoxicity, and cytokine production.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~25kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: Q96DU3

Tag: His-tag

Amino Acid Sequence: CAGAGTAGTCTGACCCCGCTGATGGTTAATGGTATTCTGGGCGAAAGTGTTACCCTGCCGCTGGAATTCCCGGCAGGCGAAAAAGTTAACTTCATTACCTGGCTGTTCAATGAAACCAGTCTGGCATTCATTGTTCCGCATGAAACCAAAAGTCCGGAAATTCATGTTACCAATCCGAAACAGGGCAAACGCCTGAACTTCACCCAGAGTTATAGCCTGCAGCTGAGTAATCTGAAAATGGAAGATACCGGTAGTTATCGTGCCCAGATTAGTACCAAAACCAGTGCAAAACTGAGCAGCTATACCCTGCGCATTCTGCGCCAGCTGCGTAATATTCAGGTGACCAATCATAGCCAGCTGTTCCAGAATATGACCTGTGAACTGCATCTGACCTGCAGCGTGGAAGATGCAGATGATAATGTGAGCTTCCGTTGGGAAGCCCTGGGCAATACCCTGAGCAGCCAGCCGAATCTGACCGTGAGCTGGGATCCGCGCATTAGTAGCGAACAGGATTATACCTGTATTGCAGAAAATGCAGTTAGTAATCTGAGCTTCAGCGTTAGTGCACAGAAACTGTGTGAAGATGTTAAAATTCAGTACACCGATACCAAAATG

Expression Vector: pet-22b(+)

Research Use Only