Product Description

CD354 Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0304-500, NCP0304-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: TREM-1 (triggering receptor expressed on myeloid cells-1) is expressed in monocytes and neutrophils but not in lymphocytes, dendritic cells, or other cell types. TREM-1 is a glycoprotein that is reduced by deglycosylation, in agreement with the predicted molecμlar mass. TREM-1 is an activating receptor of the Ig superfamily that is expressed on human myeloid cells, selectively expressed on blood neutrophils and a subset of monocytes, and is upregμlated by bacterial LPS. Immunoblot analysis shows that TREM-1 is associated with DAP12, a molecμle frequently associated with activating receptors. TREM-1 and the myeloid DAP12-associating lectin (MDL-1) are recently identified receptors which associate non-covalently with DAP12 to form receptor complexes that are involved in monocytic activation and inflammatory response.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~24kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: Q9NP99

Tag: His-tag

Amino Acid Sequence: GCAACCAAACTGACCGAAGAAAAATATGAACTGAAAGAAGGTCAGACCCTGGATGTGAAATGCGATTATACCCTGGAAAAATTCGCAAGTAGCCAGAAAGCATGGCAGATTATTCGTGATGGCGAAATGCCGAAAACCTTAGCCTGTACCGAACGTCCGAGCAAAAATAGTCATCCGGTTCAGGTTGGCCGCATTATTCTGGAAGATTATCATGATCATGGTCTGCTGCGCGTGCGTATGGTTAATCTGCAGGTGGAAGATAGTGGTCTGTATCAGTGCGTGATCTATCAGCCGCCGAAAGAACCGCACATGCTGTTCGATCGTATTCGTCTGGTGGTTACCAAAGGCTTCAGTGGCACCCCGGGTAGTAATGAAAATAGCACCCAGAATGTGTATAAAATTCCGCCGACCACCACCAAAGCCCTGTGTCCGCTGTATACCAGCCCGCGCACCGTTACCCAGGCCCCTCCTAAAAGCACCGCCGATGTGAGTACCCCGGATAGCGAAATTAATCTGACCAATGTTACCGATATTATCCGCGTTCCGGTGTTCAAT

Expression Vector: pet-22b(+)

Research Use Only