BioWorld
CD354 Recombinant Protein - NCP0304
CD354 Recombinant Protein - NCP0304
Couldn't load pickup availability
CD354 Recombinant Protein
Catalogue Number: NCP0304-500, NCP0304-1000
Sizes: 500ug, 1mg
Swiss-Prot: Q9NP99
Host: E.coli
Tag: His-tag
AA Sequence: GCAACCAAACTGACCGAAGAAAAATATGAACTGAAAGAAGGTCAGACCCTGGATGTGAAATGCGATTATACCCTGGAAAAATTCGCAAGTAGCCAGAAAGCATGGCAGATTATTCGTGATGGCGAAATGCCGAAAACCTTAGCCTGTACCGAACGTCCGAGCAAAAATAGTCATCCGGTTCAGGTTGGCCGCATTATTCTGGAAGATTATCATGATCATGGTCTGCTGCGCGTGCGTATGGTTAATCTGCAGGTGGAAGATAGTGGTCTGTATCAGTGCGTGATCTATCAGCCGCCGAAAGAACCGCACATGCTGTTCGATCGTATTCGTCTGGTGGTTACCAAAGGCTTCAGTGGCACCCCGGGTAGTAATGAAAATAGCACCCAGAATGTGTATAAAATTCCGCCGACCACCACCAAAGCCCTGTGTCCGCTGTATACCAGCCCGCGCACCGTTACCCAGGCCCCTCCTAAAAGCACCGCCGATGTGAGTACCCCGGATAGCGAAATTAATCTGACCAATGTTACCGATATTATCCGCGTTCCGGTGTTCAAT
Restriction Sites: NdeI-XhoI
Background: TREM-1 (triggering receptor expressed on myeloid cells-1) is expressed in monocytes and neutrophils but not in lymphocytes, dendritic cells, or other cell types. TREM-1 is a glycoprotein that is reduced by deglycosylation, in agreement with the predicted molecular mass. TREM-1 is an activating receptor of the Ig superfamily that is expressed on human myeloid cells, selectively expressed on blood neutrophils and a subset of monocytes, and is upregulated by bacterial LPS. Immunoblot analysis shows that TREM-1 is associated with DAP12, a molecule frequently associated with activating receptors. TREM-1 and the myeloid DAP12-associating lectin (MDL-1) are recently identified receptors which associate non-covalently with DAP12 to form receptor complexes that are involved in monocytic activation and inflammatory response.
Soluble: PBS, 4M Urea, PH7.4
Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).
Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Expression Vector: pet-22b(+)
BioWorld Molecular Weight: ~24kDa
Notes: For research use only, not for use in diagnostic procedure.