BioWorld
CD355 Recombinant Protein - NCP0305
CD355 Recombinant Protein - NCP0305
Couldn't load pickup availability
CD355 Recombinant Protein
Catalogue Number: NCP0305-500, NCP0305-1000
Sizes: 500ug, 1mg
Swiss-Prot: O95727
Host: E.coli
Tag: His-tag
AA Sequence: AGCCTGACCAATCATACCGAAACCATTACCGTTGAAGAAGGCCAGACCCTGACCCTGAAATGTGTGACCAGTCTGCGTAAAAATAGTAGCCTGCAGTGGCTGACCCCGAGCGGCTTCACCATCTTCCTGAATGAATATCCGGCCCTGAAAAATAGCAAATATCAGCTGCTGCATCATAGCGCAAATCAGCTGAGCATTACCGTGCCGAATGTTACCCTGCAGGATGAAGGCGTGTATAAATGCCTGCATTATAGTGATAGTGTGAGCACCAAAGAAGTGAAAGTTATTGTGCTGGCAACCCCGTTCAAACCGATTCTGGAAGCAAGTGTTATTCGTAAACAGAATGGCGAAGAACATGTGGTTCTGATGTGTAGTACCATGCGTAGCAAACCGCCGCCGCAGATTACCTGGCTGCTGGGTAATAGCATGGAAGTGAGCGGCGGTACCCTGCATGAATTCGAAACCGATGGTAAAAAATGCAATACCACCAGCACCCTGATTATTCATACCTATGGTAAAAATAGCACCGTTGATTGTATTATTCGTCATCGTGGTCTGCAGGGTCGCAAACTGGTTGCACCGTTCCGCTTCGAAGATCTGGTGACCGATGAAGAAACCGCCAGCGATGCACTGGAACGCAATAGCCTGAGTAGCCAGGATCCGCAGCAGCCGACCAGCACCGTTAGCGTTACCGAAGATAGCAGCACCAGTGAAATTGATAAAGAAGAAAAAGAGCAGACCACCCAGGATCCGGATCTGACCACCGAAGCCAATCCGCAGTATCTGGGCCTGGCACGTAAAAAAAGCGGC
Restriction Sites: NdeI-XhoI
Background: CD355, mediates heterophilic cell-cell adhesion which regulates the activation, differentiation and tissue retention of various T-cell subsets. Interaction with CADM1 promotes natural killer (NK) cell cytotoxicity and IFNG/interferon-gamma secretion by CD8+ T-cells in vitro as well as NK cell-mediated rejection of tumors expressing CADM1 in vivo. Regulates CD8+ T-cell proliferation in response to T-cell receptor (TCR) activation. Appears to be dispensable for CD8+ T-cell-mediated cytotoxicity. Interaction with SCRIB promotes the late phase of cellular polarization of a subset of CD4+ T-cells, which in turn regulates TCR-mediated proliferation and IFNG, IL17 and IL22 production.
By interacting with CADM1 on CD8+ dendritic cells, regulates the retention of activated CD8+ T-cells within the draining lymph node (By similarity).
Required for the intestinal retention of intraepithelial CD4+ CD8+ T-cells and, to a lesser extent, intraepithelial and lamina propria CD8+ T-cells and CD4+ T-cells (By similarity).
Interaction with CADM1 promotes the adhesion to gut-associated CD103+ dendritic cells, which may facilitate the expression of gut-homing and adhesion molecules on T-cells and the conversion of CD4+ T-cells into CD4+ CD8+ T-cells (By similarity).
Soluble: PBS, 4M Urea, PH7.4
Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).
Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Expression Vector: pet-22b(+)
BioWorld Molecular Weight: ~40kDa
Notes: For research use only, not for use in diagnostic procedure.