CD357 Recombinant Protein - NCP0306

CD357 Recombinant Protein

Catalogue Number: NCP0306-500, NCP0306-1000

Sizes: 500ug, 1mg

Swiss-Prot: Q9Y5U5

Host: E.coli

Tag: His-tag

AA Sequence: CAGCGTCCTACCGGTGGCCCTGGTTGTGGTCCGGGTCGTCTGCTGCTGGGTACCGGTACCGATGCACGTTGTTGTCGTGTTCATACCACCCGCTGTTGTCGCGATTATCCGGGCGAAGAATGCTGTAGCGAATGGGATTGTATGTGCGTTCAGCCGGAATTCCATTGTGGCGATCCGTGTTGTACCACCTGTCGTCATCATCCGTGTCCGCCGGGCCAGGGTGTGCAGTCACAGGGTAAATTCAGCTTCGGCTTCCAGTGCATTGATTGTGCCAGTGGCACCTTCAGCGGTGGCCATGAAGGTCATTGCAAACCGTGGACCGATTGTACCCAGTTCGGCTTCCTGACCGTGTTCCCGGGCAATAAAACACATAATGCCGTGTGTGTTCCGGGTAGCCCGCCGGCAGAACCG

Restriction Sites: NdeI-XhoI

Background: TNFRSF18, also known as glucocorticoid-induced tumor necrosis factor-receptor (TNFR)-related protein (GITR) and activation-inducible TNFR family receptor, encodes a type 1 membrane protein of the TNF-receptor superfamily. Three alternatively spliced transcript variants encoding distinct isoforms have been reported. GITR is an immune cell co-stimulatory receptor expressed constitutively at high levels on CD4+CD25+ T regulatory cells (Tregs), at low levels on naïve and memory T cells, and is induced upon T cell activation. Studies show GITR can also be induced on NK cells, macrophages, and DCs. Although GITR does not have intrinsic enzymatic activity, TNFSF18 (also known as GITRL) expressed on antigen presenting cells binds to GITR, resulting in recruitment of TNFR-associated factor family members and activation of the NF-κB pathway in T cells. GITR ligation has been shown to play a role in CD8+ T cell activation, cytotoxicity, and memory T cell survival. In the thymus, GITR is thought to play a key role in dominant immunological self-tolerance through thymic Treg differentiation and expansion. Of note, GITR ligation inhibits Treg suppressive function and promotes effector T cell resistance to Treg suppression. Due to the combined effects on both Treg suppression and effector cell activation, GITR represents a unique opportunity for immunotherapeutic intervention in cancer.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~22kDa

Notes: For research use only, not for use in diagnostic procedure.