Product Description

CD358 Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0307-500, NCP0307-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: The tumor necrosis factor receptor family, which includes TNF-RI, Fas, DR3, DR4, DR5, and DR6, plays an important role in the regμlation of apoptosis in various physiological systems. The receptors are activated by a family of cytokines that include TNF, FasL, and TNF-related apoptosis-inducing ligand (TRAIL). They are characterized by a highly conserved extracellμlar region containing cysteine-rich repeats and a conserved intracellμlar region of about 80 amino acids termed the death domain (DD). The DD is important for transducing the death signal by recruiting other DD containing adaptor proteins (FADD, TRADD, RIP) to the death-inducing signaling complex (DISC), resμlting in activation of caspases. DR6, also known as TNFRSF21, is a TNFR family member able to induce apoptosis as well as activation of NF-κB and JNK. Expression of DR6 is upregμlated by NF-κB signaling. DR6 appears to play a critical role in the activation and differentiation of T and B lymphocytes. In the nervous system, β-amyloid precursor protein (APP) activates DR6 to trigger neuronal degeneration.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~35kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: O75509

Tag: His-tag

Amino Acid Sequence: CAGCCTGAACAGAAAGCCAGTAATCTGATTGGTACCTATCGCCATGTTGATCGCGCCACCGGTCAGGTGCTGACCTGCGATAAATGTCCGGCAGGCACCTATGTTAGCGAACATTGTACCAATACCAGTCTGCGCGTGTGCAGTAGCTGTCCGGTTGGTACCTTCACCCGTCATGAAAATGGCATTGAAAAATGCCATGATTGTAGTCAGCCGTGTCCGTGGCCGATGATTGAAAAACTGCCGTGCGCCGCCCTGACCGATCGCGAATGTACCTGCCCGCCGGGCATGTTCCAGAGTAATGCAACCTGCGCCCCGCATACCGTGTGTCCGGTTGGCTGGGGTGTTCGTAAAAAAGGTACCGAAACCGAAGATGTGCGTTGTAAACAGTGTGCCCGCGGTACCTTCAGCGATGTGCCGAGCAGCGTTATGAAATGCAAAGCATATACCGATTGCCTGAGCCAGAATCTGGTTGTGATTAAACCGGGCACCAAAGAAACCGATAATGTGTGTGGCACCCTGCCGAGCTTCAGTAGCAGTACCAGCCCGAGTCCGGGCACCGCAATCTTCCCGCGCCCGGAACACATGGAAACACATGAAGTGCCGAGCTCAACCTATGTGCCGAAAGGTATGAATAGCACCGAAAGTAATAGCAGTGCCAGTGTTCGCCCGAAAGTTCTGAGCAGCATTCAGGAAGGCACCGTTCCGGATAATACCAGTAGTGCCCGTGGTAAAGAAGATGTTAATAAAACCTTACCGAACCTGCAGGTTGTTAATCATCAGCAGGGTCCGCATCATCGTCATATTCTGAAACTGCTGCCGAGCATGGAAGCAACCGGCGGCGAAAAAAGCAGTACCCCGATTAAAGGTCCGAAACGCGGTCATCCGCGCCAGAATCTGCATAAACACTTCGATATTAATGAGCAT

Expression Vector: pet-22b(+)

Research Use Only