Product Description

CD362 Recombinant Protein

Catalogue Number: NCP0310-500, NCP0310-1000

Sizes: 500ug, 1mg

Swiss-Prot: P34741

Host: E.coli

Tag: His-tag

AA Sequence: GAAAGCCGCGCCGAACTGACCAGCGATAAAGATATGTATCTGGATAATAGCAGCATTGAAGAAGCAAGCGGTGTGTATCCGATTGATGATGATGATTATGCAAGTGCCAGCGGTAGCGGTGCAGATGAAGATGTGGAAAGCCCGGAACTGACCACCAGTCGTCCGCTGCCGAAAATTCTGCTGACCAGCGCCGCCCCGAAAGTTGAAACCACCACCCTGAATATTCAGAATAAAATTCCGGCCCAGACCAAAAGTCCGGAAGAAACCGATAAAGAAAAAGTGCATCTGAGCGATAGTGAACGCAAAATGGATCCGGCAGAAGAAGATACCAATGTGTATACCGAAAAACATAGCGATAGTCTGTTCAAACGCACCGAA

Restriction Sites: NdeI-XhoI

Background: Syndecans are type I integral membrane proteoglycans that contain both chondroitin sulfate and heparan sulfate groups. Syndecans are involved in cell-extracellular matrix adhesion and growth factor binding. Syndecan-1 (SYND1, also called CD138) is anextracellular matrix receptor which binds to collagens, Fibronectin and Thrombospondin. Syndecan-1 and Syndecan-3 (also designated N-Syndecan) interact with MK (midkine), a growth/differentiation factor invloved in embryogenesis of the central nervous system. Syndecan-2 (also designated fibroglycan or HSPG) is highly expressed at areas of high morphogenetic activity, such as epithelial-mesenchymal interfaces and the prechondrogenic and preosteogenic mesenchymal condensations.
Syndecan-4 (also designated amphiglycan or ryudocan) functions cooperativley
with integrins in the processes of cell spreading, focal adhesion assembly and
Actin stress fiber assembly

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~27kDa

Notes: For research use only, not for use in diagnostic procedure.