CD3E Recombinant Protein - NCP0204

CD3E Recombinant Protein

Catalogue Number: NCP0204-500, NCP0204-1000

Sizes: 500ug, 1mg

Swiss-Prot: P07766

Host: E.coli

Tag: His-tag

AA Sequence: GATGGTAATGAAGAAATGGGCGGTATTACCCAGACCCCGTATAAAGTTAGTATTAGTGGCACCACCGTTATTCTGACCTGTCCGCAGTATCCGGGTAGCGAAATTCTGTGGCAGCATAATGATAAAAATATCGGCGGTGATGAAGATGATAAAAATATTGGTAGCGATGAAGATCATCTGAGTCTGAAAGAATTCAGTGAACTGGAACAGAGCGGTTATTATGTGTGTTATCCGCGCGGTAGTAAACCGGAAGATGCCAACTTCTATCTGTATCTGCGTGCACGCGTGTGTGAAAATTGTATGGAAATGGAT

Restriction Sites: NdeI-XhoI

Background: When T cells encounter antigens via the T cell receptor (TCR), information about the quantity and quality of antigens is relayed to the intracellular signal transduction machinery. This activation process depends mainly on CD3 (Cluster of Differentiation 3), a multiunit protein complex that directly associates with the TCR. CD3 is composed of four polypeptides: ζ, γ, ε and δ. Each of these polypeptides contains at least one immunoreceptor tyrosine-based activation motif (ITAM). Engagement of TCR complex with foreign antigens induces tyrosine phosphorylation in the ITAM motifs and phosphorylated ITAMs function as docking sites for signaling molecules such as ZAP-70 and p85 subunit of PI-3 kinase. TCR ligation also induces a conformational change in CD3ε, such that a proline region is exposed and then associates with the adaptor protein Nck.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~18kDa

Notes: For research use only, not for use in diagnostic procedure.