Product Description

CD3G Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0205-500, NCP0205-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: The T cell antigen receptor (TCR) recognizes foreign antigens and translates such recognition events into intracellμlar signals that elicit a change in the cell from a dormant to an activated state. Much of this signaling process can be attributed to a mμltisubunit complex of proteins that associates directly with the TCR. This complex has been designated CD3 (cluster of differentiation 3). It is composed of five invariant polypeptide chains that associate to form three dimers: a heterodimer of γ and ε chains (γε), a heterodimer of δ and ε chains
(δε) and a homodimer of two ζ chains (ζζ) or a heterodimer of ζ and η chains (ζη). The ζ and η chains are encoded by the same gene but differ in their carboxyl-terminal ends due to an alternative splicing event. The γ, ε and δ chains each contain a single copy of a conserved immunoreceptor tyrosinebased activation motif (ITAM). In contrast, the ζ chain contains three consecutive copies of the same motif. Phosphorylated ITAMs act as docking sites for protein kinases such as ZAP-70 and Syk and are also capable of regμlating their kinase activity. The crystal structure of the ZAP-70 SH2 domains bound to the ζ chain ITAMs has been solved.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~13kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: P09693

Tag: His-tag

Amino Acid Sequence: CAGAGTATTAAGGGCAATCATCTGGTGAAAGTGTATGATTATCAGGAAGATGGCAGCGTGCTGCTGACCTGCGATGCCGAAGCCAAAAATATTACCTGGTTCAAAGATGGTAAGATGATTGGCTTCCTGACCGAAGATAAAAAAAAATGGAATCTGGGCAGCAATGCCAAAGATCCGCGCGGTATGTATCAGTGCAAAGGTAGCCAGAATAAAAGCAAACCGCTGCAGGTGTATTATCGCATGTGTCAGAATTGCATTGAACTGAATGCAGCAACCATTAGC

Expression Vector: pet-22b(+)

Research Use Only