Product Description

CD3G Recombinant Protein

Catalogue Number: NCP0205-500, NCP0205-1000

Sizes: 500ug, 1mg

Swiss-Prot: P09693

Host: E.coli

Tag: His-tag

AA Sequence: CAGAGTATTAAGGGCAATCATCTGGTGAAAGTGTATGATTATCAGGAAGATGGCAGCGTGCTGCTGACCTGCGATGCCGAAGCCAAAAATATTACCTGGTTCAAAGATGGTAAGATGATTGGCTTCCTGACCGAAGATAAAAAAAAATGGAATCTGGGCAGCAATGCCAAAGATCCGCGCGGTATGTATCAGTGCAAAGGTAGCCAGAATAAAAGCAAACCGCTGCAGGTGTATTATCGCATGTGTCAGAATTGCATTGAACTGAATGCAGCAACCATTAGC

Restriction Sites: NdeI-XhoI

Background: The T cell antigen receptor (TCR) recognizes foreign antigens and translates such recognition events into intracellular signals that elicit a change in the cell from a dormant to an activated state. Much of this signaling process can be attributed to a multisubunit complex of proteins that associates directly with the TCR. This complex has been designated CD3 (cluster of differentiation 3). It is composed of five invariant polypeptide chains that associate to form three dimers: a heterodimer of γ and ε chains (γε), a heterodimer of δ and ε chains
(δε) and a homodimer of two ζ chains (ζζ) or a heterodimer of ζ and η chains (ζη). The ζ and η chains are encoded by the same gene but differ in their carboxyl-terminal ends due to an alternative splicing event. The γ, ε and δ chains each contain a single copy of a conserved immunoreceptor tyrosinebased activation motif (ITAM). In contrast, the ζ chain contains three consecutive copies of the same motif. Phosphorylated ITAMs act as docking sites for protein kinases such as ZAP-70 and Syk and are also capable of regulating their kinase activity. The crystal structure of the ZAP-70 SH2 domains bound to the ζ chain ITAMs has been solved.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~13kDa

Notes: For research use only, not for use in diagnostic procedure.