Product Description

CD40L Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0209-500, NCP0209-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: CD40 ligand (CD40L), also known as CD154, TRAP, and gp39, is the ligand for the TNF receptor family member CD40. CD40L is expressed either as a soluble cytokine or as a homotrimeric transmembrane protein. CD40L primarily expressed on the surface of T-cells, but has also been reported in blood platelets, mast cells, basophils, NK cells, and B-cells. It plays an important role in stimμlating B-cell cell proliferation and survival and promotes immunoglobμlin class switching and secretion of IgE. Signals generated by CD40 vary depending on cell type and include activation of MAPK pathways as well as NF-κB. Mutations within the CD40L gene are associated with X-linked hyper-IgM syndrome characterized by high serum levels of IgM and decreased levels of other isotypes. The CD40L/CD40 pathway is an important area of interest in the study of cancer, vascμlar diseases, and inflammatory disorders.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~30kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: P29965

Tag: His-tag

Amino Acid Sequence: CATCGTCGCCTGGATAAAATTGAAGATGAACGTAATCTGCATGAAGACTTCGTGTTCATGAAAACCATTCAGCGTTGCAATACCGGTGAACGTAGTCTGAGTCTGCTGAATTGCGAAGAAATTAAAAGTCAGTTCGAAGGCTTCGTTAAAGATATTATGCTGAATAAAGAGGAGACCAAAAAAGAAAATAGCTTCGAAATGCAGAAGGGTGATCAGAATCCGCAGATTGCAGCCCATGTGATTAGTGAAGCCAGTAGTAAAACCACCAGTGTGCTGCAGTGGGCCGAAAAAGGTTATTATACCATGAGCAATAACCTGGTTACCCTGGAAAATGGTAAACAGCTGACCGTGAAACGTCAGGGCCTGTATTATATCTATGCACAGGTGACCTTCTGCAGTAATCGTGAAGCCAGCAGTCAGGCACCGTTCATTGCAAGTCTGTGTCTGAAAAGTCCGGGCCGCTTCGAACGTATTCTGCTGCGCGCAGCCAATACCCATAGTAGCGCCAAACCGTGCGGTCAGCAGAGCATTCATCTGGGCGGTGTGTTCGAACTGCAGCCGGGTGCCAGTGTGTTCGTGAATGTTACCGATCCGAGTCAGGTTAGCCATGGTACCGGCTTCACCAGCTTCGGCCTGCTGAAACTG

Expression Vector: pet-22b(+)

Research Use Only