Skip to product information
1 of 1

BioWorld

CD40L Recombinant Protein - NCP0209

CD40L Recombinant Protein - NCP0209

Regular price $1,050.83 CAD
Regular price Sale price $1,050.83 CAD
Sale Sold out
Size
Quantity

Get a quote

CD40L Recombinant Protein

Catalogue Number: NCP0209-500, NCP0209-1000

Sizes: 500ug, 1mg

Swiss-Prot: P29965

Host: E.coli

Tag: His-tag

AA Sequence: CATCGTCGCCTGGATAAAATTGAAGATGAACGTAATCTGCATGAAGACTTCGTGTTCATGAAAACCATTCAGCGTTGCAATACCGGTGAACGTAGTCTGAGTCTGCTGAATTGCGAAGAAATTAAAAGTCAGTTCGAAGGCTTCGTTAAAGATATTATGCTGAATAAAGAGGAGACCAAAAAAGAAAATAGCTTCGAAATGCAGAAGGGTGATCAGAATCCGCAGATTGCAGCCCATGTGATTAGTGAAGCCAGTAGTAAAACCACCAGTGTGCTGCAGTGGGCCGAAAAAGGTTATTATACCATGAGCAATAACCTGGTTACCCTGGAAAATGGTAAACAGCTGACCGTGAAACGTCAGGGCCTGTATTATATCTATGCACAGGTGACCTTCTGCAGTAATCGTGAAGCCAGCAGTCAGGCACCGTTCATTGCAAGTCTGTGTCTGAAAAGTCCGGGCCGCTTCGAACGTATTCTGCTGCGCGCAGCCAATACCCATAGTAGCGCCAAACCGTGCGGTCAGCAGAGCATTCATCTGGGCGGTGTGTTCGAACTGCAGCCGGGTGCCAGTGTGTTCGTGAATGTTACCGATCCGAGTCAGGTTAGCCATGGTACCGGCTTCACCAGCTTCGGCCTGCTGAAACTG

Restriction Sites: NdeI-XhoI

Background: CD40 ligand (CD40L), also known as CD154, TRAP, and gp39, is the ligand for the TNF receptor family member CD40. CD40L is expressed either as a soluble cytokine or as a homotrimeric transmembrane protein. CD40L primarily expressed on the surface of T-cells, but has also been reported in blood platelets, mast cells, basophils, NK cells, and B-cells. It plays an important role in stimulating B-cell cell proliferation and survival and promotes immunoglobulin class switching and secretion of IgE. Signals generated by CD40 vary depending on cell type and include activation of MAPK pathways as well as NF-κB. Mutations within the CD40L gene are associated with X-linked hyper-IgM syndrome characterized by high serum levels of IgM and decreased levels of other isotypes. The CD40L/CD40 pathway is an important area of interest in the study of cancer, vascular diseases, and inflammatory disorders.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~30kDa

Notes: For research use only, not for use in diagnostic procedure.

View full details