Product Description

CD48 Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0213-500, NCP0213-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: CD48 is a glycosylphosphatidylinositol (GPI) -anchored membrane protein of the signaling lymphocyte activation molecμle (SLAM) family, also known as SLAMF2 and BLAST-1. It is constitutively expressed on most hematopoietic cells (not on neutrophils and a subset of long-term hematopoietic stem cells in mice) and can be upregμlated under certain conditions like infection. Interaction with its low affinity ligand CD2 promotes adhesion and TCR signaling. Interaction with the high affinity ligand CD244 (2B4) regμlates natural killer (NK) and CD8 T cell activation and cytolytic function.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~21kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: P09326

Tag: His-tag

Amino Acid Sequence: CAGGGTCATCTGGTTCACATGACCGTTGTGAGCGGTAGCAATGTTACCCTGAATATTAGCGAAAGCCTGCCGGAAAATTATAAACAGCTGACCTGGTTCTATACCTTCGATCAGAAAATTGTGGAATGGGATAGTCGTAAAAGTAAATACTTCGAAAGCAAATTCAAGGGCCGTGTGCGTCTGGATCCGCAGAGCGGCGCCCTGTATATTAGCAAAGTTCAGAAAGAAGATAACAGTACCTATATTATGCGCGTGCTGAAAAAAACCGGTAATGAACAGGAATGGAAAATTAAACTGCAGGTGCTGGATCCGGTGCCGAAACCGGTTATTAAAATTGAAAAAATCGAGGATATGGACGATAATTGTTATCTGAAACTGAGTTGCGTGATTCCGGGTGAAAGCGTTAATTATACCTGGTATGGCGATAAACGTCCGTTCCCGAAAGAACTGCAGAATAGCGTTCTGGAAACCACCCTGATGCCGCATAATTATAGTCGCTGTTATACCTGTCAGGTTAGTAATAGTGTTAGCAGCAAAAATGGTACCGTGTGTCTGAGTCCGCCGTGTACCCTGGCACGTAGT

Expression Vector: pet-22b(+)

Research Use Only