Product Description

CD48 Recombinant Protein

Catalogue Number: NCP0213-500, NCP0213-1000

Sizes: 500ug, 1mg

Swiss-Prot: P09326

Host: E.coli

Tag: His-tag

AA Sequence: CAGGGTCATCTGGTTCACATGACCGTTGTGAGCGGTAGCAATGTTACCCTGAATATTAGCGAAAGCCTGCCGGAAAATTATAAACAGCTGACCTGGTTCTATACCTTCGATCAGAAAATTGTGGAATGGGATAGTCGTAAAAGTAAATACTTCGAAAGCAAATTCAAGGGCCGTGTGCGTCTGGATCCGCAGAGCGGCGCCCTGTATATTAGCAAAGTTCAGAAAGAAGATAACAGTACCTATATTATGCGCGTGCTGAAAAAAACCGGTAATGAACAGGAATGGAAAATTAAACTGCAGGTGCTGGATCCGGTGCCGAAACCGGTTATTAAAATTGAAAAAATCGAGGATATGGACGATAATTGTTATCTGAAACTGAGTTGCGTGATTCCGGGTGAAAGCGTTAATTATACCTGGTATGGCGATAAACGTCCGTTCCCGAAAGAACTGCAGAATAGCGTTCTGGAAACCACCCTGATGCCGCATAATTATAGTCGCTGTTATACCTGTCAGGTTAGTAATAGTGTTAGCAGCAAAAATGGTACCGTGTGTCTGAGTCCGCCGTGTACCCTGGCACGTAGT

Restriction Sites: NdeI-XhoI

Background: CD48 is a glycosylphosphatidylinositol (GPI) -anchored membrane protein of the signaling lymphocyte activation molecule (SLAM) family, also known as SLAMF2 and BLAST-1. It is constitutively expressed on most hematopoietic cells (not on neutrophils and a subset of long-term hematopoietic stem cells in mice) and can be upregulated under certain conditions like infection. Interaction with its low affinity ligand CD2 promotes adhesion and TCR signaling. Interaction with the high affinity ligand CD244 (2B4) regulates natural killer (NK) and CD8 T cell activation and cytolytic function.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~21kDa

Notes: For research use only, not for use in diagnostic procedure.