Product Description

CD5 Recombinant Protein

Catalogue Number: NCP0214-500, NCP0214-1000

Sizes: 500ug, 1mg

Swiss-Prot: P06127

Host: E.coli

Tag: His-tag

AA Sequence: CGTCTGAGTTGGTATGATCCGGACTTCCAGGCACGCCTGACCCGCAGTAATAGTAAATGTCAGGGTCAGCTGGAAGTGTATCTGAAAGATGGCTGGCACATGGTGTGTAGCCAGAGCTGGGGTCGTAGCAGTAAACAGTGGGAAGATCCGAGCCAGGCCAGTAAAGTGTGTCAGCGTCTGAATTGTGGTGTGCCGCTGAGTCTGGGCCCGTTCCTGGTTACCTATACCCCGCAGAGCAGCATTATCTGTTATGGCCAGCTGGGTAGCTTCAGTAATTGTAGTCATAGTCGCAATGATATGTGCCATAGTCTGGGTCTGACCTGCCTGGAACCGCAGAAAACCACCCCGCCGACCACCCGTCCGCCGCCTACCACCACACCGGAACCGACCGCACCGCCGCGTCTGCAACTGGTTGCACAGAGCGGCGGCCAGCATTGTGCAGGCGTGGTGGAATTCTATAGCGGTAGCCTGGGCGGTACCATTAGTTATGAAGCACAGGATAAAACACAAGATCTGGAAAACTTCCTGTGTAATAATCTGCAGTGTGGCAGCTTCCTGAAACATCTGCCGGAAACCGAAGCCGGTCGTGCACAGGATCCGGGTGAACCGCGTGAACATCAGCCGCTGCCGATTCAGTGGAAAATTCAGAATAGTAGTTGCACCAGCCTGGAACATTGCTTCCGCAAAATTAAACCGCAGAAAAGCGGCCGCGTTCTGGCCCTGCTGTGTAGCGGCTTCCAGCCGAAAGTGCAGAGTCGCCTGGTTGGCGGTAGTAGTATCTGTGAAGGTACCGTTGAAGTTCGCCAGGGTGCACAGTGGGCAGCACTGTGCGATAGTAGTAGTGCCCGCAGCAGCCTGCGCTGGGAAGAAGTGTGTCGTGAACAGCAGTGTGGCTCAGTGAATAGTTATCGCGTTCTGGATGCAGGTGATCCGACCAGTCGTGGTCTGTTCTGTCCGCATCAGAAACTGAGCCAGTGTCATGAACTGTGGGAACGTAATAGCTATTGTAAAAAAGTGTTCGTTACCTGCCAGGATCCGAATCCG

Restriction Sites: NdeI-XhoI

Background: CD5 is a type-I transmembrane protein belonging to the scavenger receptor cysteine-rich (SRCR) family, characterized by the presence of at least one SRCR domain of 90-110 amino acids. CD5 is expressed by all mature T cells, the B-1a subset of mature B cells, and some leukemic B cells. Its expression is increased in regulatory T and B cells (Tregs/Bregs). Anergic T and B cells also have elevated CD5 expression. Elevated levels of CD5 are also found in many autoimmune disorders. CD5 is associated with the T cell receptor (TCR) and negatively modulates T cell activation and differentiation. CD5 expression on the tumor infiltrating T lymphocytes is inversely correlated with their antitumor activity. Recently it was reported that CD5 directly binds to IL6 and can mediate downstream signaling. CD5+ B cells promote tumor growth in animal models. Reagents targeting CD5 have been actively pursued as therapeutic interventions for cancer and other conditions.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~38kDa

Notes: For research use only, not for use in diagnostic procedure.