Product Description

CD57 Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0216-500, NCP0216-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: Galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 1 (B3GAT1), also known as beta-1,3-glucuronyltransferase 1 and glucuronosyltransferase P, is a type II membrane protein enzyme encoded by the B3GAT1 gene. This gene is localized on the 11q25 chromosome and is a member of the glucuronyltransferase gene family. B3GAT1 is one of the enzymes involved in the biosynthesis of carbohydrate epitope human natural killer-1 (HNK-1), also known as CD57 and Leu7. B3GAT1 catalyzes the glucuronyl transfer reaction that adds a glucuronic acid to the terminal N-acetyllactosamine (Lac) disaccharide to form the CD57 epitope on a variety of proteins, lipids, and chondroitin sμlfate proteoglycans at the cell surface. CD57 is present on a subset of peripheral blood lymphocytes, including NK cells and CD8+ T cells, as well as neural cells and striated muscle. The CD57 epitope may play a role in neural cell adhesion, and characterizes unique maturation states in T and NK cells.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~35kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: Q9P2W7

Tag: His-tag

Amino Acid Sequence: ACCCTGGCTCCGCTGCTGGCAGTTCATAAAGATGAAGGTAGTGATCCGCGTCGTGAAACACCTCCGGGTGCCGATCCGCGCGAATATTGCACCAGTGATCGCGATATTGTGGAAGTTGTGCGTACCGAATATGTGTATACCCGTCCGCCGCCGTGGAGTGATACCCTGCCGACCATTCATGTGGTTACCCCGACCTATAGTCGTCCGGTTCAGAAAGCAGAACTGACCCGTATGGCCAATACCCTGCTGCATGTTCCGAATCTGCATTGGCTGGTTGTGGAAGATGCCCCGCGCCGCACCCCGTTAACCGCTAGACTGCTGCGTGATACCGGTCTGAATTATACCCATCTGCATGTGGAAACACCTCGTAATTATAAACTGCGTGGCGATGCCCGTGATCCGCGTATTCCGCGCGGTACCATGCAGCGCAATCTGGCCCTGCGTTGGCTGCGTGAAACCTTCCCGCGTAATAGCAGCCAGCCGGGTGTGGTGTACTTCGCCGATGATGATAATACCTATAGTCTGGAACTGTTCGAAGAAATGCGTAGTACCCGTCGCGTTAGTGTGTGGCCGGTGGCATTCGTGGGCGGCCTGCGTTATGAAGCACCGCGCGTGAATGGTGCAGGTAAAGTTGTGGGCTGGAAAACCGTGTTCGATCCGCATCGCCCGTTCGCAATTGATATGGCCGGCTTCGCCGTGAATCTGCGTCTGATTCTGCAGCGTAGCCAGGCCTACTTCAAACTGCGTGGTGTTAAAGGTGGTTATCAGGAAAGCAGCCTGCTGCGCGAACTGGTTACCCTGAATGATCTGGAACCGAAAGCAGCCAATTGTACCAAAATTCTGGTGTGGCATACCCGTACCGAAAAACCGGTGCTGGTTAATGAAGGCAAAAAAGGCTTCACCGATCCGAGCGTGGAAATT

Expression Vector: pet-22b(+)

Research Use Only