Skip to product information
1 of 1

BioWorld

CD57 Recombinant Protein - NCP0216

CD57 Recombinant Protein - NCP0216

Regular price $1,050.83 CAD
Regular price Sale price $1,050.83 CAD
Sale Sold out
Size
Quantity

Get a quote

CD57 Recombinant Protein

Catalogue Number: NCP0216-500, NCP0216-1000

Sizes: 500ug, 1mg

Swiss-Prot: Q9P2W7

Host: E.coli

Tag: His-tag

AA Sequence: ACCCTGGCTCCGCTGCTGGCAGTTCATAAAGATGAAGGTAGTGATCCGCGTCGTGAAACACCTCCGGGTGCCGATCCGCGCGAATATTGCACCAGTGATCGCGATATTGTGGAAGTTGTGCGTACCGAATATGTGTATACCCGTCCGCCGCCGTGGAGTGATACCCTGCCGACCATTCATGTGGTTACCCCGACCTATAGTCGTCCGGTTCAGAAAGCAGAACTGACCCGTATGGCCAATACCCTGCTGCATGTTCCGAATCTGCATTGGCTGGTTGTGGAAGATGCCCCGCGCCGCACCCCGTTAACCGCTAGACTGCTGCGTGATACCGGTCTGAATTATACCCATCTGCATGTGGAAACACCTCGTAATTATAAACTGCGTGGCGATGCCCGTGATCCGCGTATTCCGCGCGGTACCATGCAGCGCAATCTGGCCCTGCGTTGGCTGCGTGAAACCTTCCCGCGTAATAGCAGCCAGCCGGGTGTGGTGTACTTCGCCGATGATGATAATACCTATAGTCTGGAACTGTTCGAAGAAATGCGTAGTACCCGTCGCGTTAGTGTGTGGCCGGTGGCATTCGTGGGCGGCCTGCGTTATGAAGCACCGCGCGTGAATGGTGCAGGTAAAGTTGTGGGCTGGAAAACCGTGTTCGATCCGCATCGCCCGTTCGCAATTGATATGGCCGGCTTCGCCGTGAATCTGCGTCTGATTCTGCAGCGTAGCCAGGCCTACTTCAAACTGCGTGGTGTTAAAGGTGGTTATCAGGAAAGCAGCCTGCTGCGCGAACTGGTTACCCTGAATGATCTGGAACCGAAAGCAGCCAATTGTACCAAAATTCTGGTGTGGCATACCCGTACCGAAAAACCGGTGCTGGTTAATGAAGGCAAAAAAGGCTTCACCGATCCGAGCGTGGAAATT

Restriction Sites: NdeI-XhoI

Background: Galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 1 (B3GAT1), also known as beta-1,3-glucuronyltransferase 1 and glucuronosyltransferase P, is a type II membrane protein enzyme encoded by the B3GAT1 gene. This gene is localized on the 11q25 chromosome and is a member of the glucuronyltransferase gene family. B3GAT1 is one of the enzymes involved in the biosynthesis of carbohydrate epitope human natural killer-1 (HNK-1), also known as CD57 and Leu7. B3GAT1 catalyzes the glucuronyl transfer reaction that adds a glucuronic acid to the terminal N-acetyllactosamine (Lac) disaccharide to form the CD57 epitope on a variety of proteins, lipids, and chondroitin sulfate proteoglycans at the cell surface. CD57 is present on a subset of peripheral blood lymphocytes, including NK cells and CD8+ T cells, as well as neural cells and striated muscle. The CD57 epitope may play a role in neural cell adhesion, and characterizes unique maturation states in T and NK cells.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~35kDa

Notes: For research use only, not for use in diagnostic procedure.

View full details