Product Description

CD59 Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0217-500, NCP0217-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: CD59 is a GPI-anchored membrane protein that functions as inhibitor of the complement membrane attack complex (MAC). CD59 binds to complement components C8 and C9, preventing C9 polymerization and insertion into membranes, therefore inhibiting the complement-dependent cytolysis (CDC). CD59 is a ubiquitously expressed cell membrane protein that protects cells from CDC. Rare cases of CD59 deficiency have been reported to cause paroxysmal nocturnal hemoglobinuria in human patients. Expression of CD59 on tumor cells and viral infected cells makes them resist antibody-dependent complement-mediated lysis. Potent inhibitors for CD59 have been actively pursued for therapeutic applications. In addition, CD59 may regμlate insμlin secretion by modμlating exocytosis.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~9kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: P13987

Tag: His-tag

Amino Acid Sequence: CTGCAGTGTTATAATTGTCCGAATCCGACCGCAGATTGTAAAACCGCCGTGAATTGTAGTAGTGACTTCGATGCATGTCTGATTACCAAAGCAGGCCTGCAGGTGTATAATAAATGCTGGAAATTCGAACATTGCAACTTCAATGATGTTACCACCCGCCTGCGCGAAAATGAACTGACCTATTATTGCTGTAAAAAGGATCTGTGCAACTTCAACGAACAGCTGGAAAAT

Expression Vector: pet-22b(+)

Research Use Only