Product Description

CD59 Recombinant Protein

Catalogue Number: NCP0217-500, NCP0217-1000

Sizes: 500ug, 1mg

Swiss-Prot: P13987

Host: E.coli

Tag: His-tag

AA Sequence: CTGCAGTGTTATAATTGTCCGAATCCGACCGCAGATTGTAAAACCGCCGTGAATTGTAGTAGTGACTTCGATGCATGTCTGATTACCAAAGCAGGCCTGCAGGTGTATAATAAATGCTGGAAATTCGAACATTGCAACTTCAATGATGTTACCACCCGCCTGCGCGAAAATGAACTGACCTATTATTGCTGTAAAAAGGATCTGTGCAACTTCAACGAACAGCTGGAAAAT

Restriction Sites: NdeI-XhoI

Background: CD59 is a GPI-anchored membrane protein that functions as inhibitor of the complement membrane attack complex (MAC). CD59 binds to complement components C8 and C9, preventing C9 polymerization and insertion into membranes, therefore inhibiting the complement-dependent cytolysis (CDC). CD59 is a ubiquitously expressed cell membrane protein that protects cells from CDC. Rare cases of CD59 deficiency have been reported to cause paroxysmal nocturnal hemoglobinuria in human patients. Expression of CD59 on tumor cells and viral infected cells makes them resist antibody-dependent complement-mediated lysis. Potent inhibitors for CD59 have been actively pursued for therapeutic applications. In addition, CD59 may regulate insulin secretion by modulating exocytosis.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~9kDa

Notes: For research use only, not for use in diagnostic procedure.