Product Description

CD63 Recombinant Protein

Catalogue Number: NCP0219-500, NCP0219-1000

Sizes: 500ug, 1mg

Swiss-Prot: P08962

Host: E.coli

Tag: His-tag

AA Sequence: GCTGGTTATGTGTTCCGTGATAAAGTTATGAGCGAATTCAATAATAACTTCCGTCAGCAGATGGAAAATTATCCGAAAAATAATCACACCGCAAGCATTCTGGATCGCATGCAGGCCGACTTCAAATGTTGTGGCGCAGCAAATTATACCGATTGGGAAAAAATTCCGAGCATGAGCAAAAATCGTGTGCCGGATAGCTGCTGCATTAATGTTACCGTTGGTTGCGGTATTAACTTCAATGAAAAAGCCATTCATAAGGAAGGTTGCGTTGAAAAAATTGGTGGTTGGCTGCGTAAAAATGTT

Restriction Sites: NdeI-XhoI

Background: CD63 belongs to the tetraspanin family, which is characterized by four transmembrane domains, one short extracellular domain (ECL1), and one long extracellular domain (ECL2). Tetraspanins interact with a variety of cell surface proteins and intracellular signaling molecules in specialized tetraspanin enriched microdomains (TEMs) where they mediate a range of processes including adhesion, motility, membrane organization, and signal transduction. CD63, like other tetraspanins, is enriched in exosomes. It is also a component of Weibel-Palade bodies found in endothelial cells. Research studies demonstrate several functions of CD63 in different cell types including roles in mast cell degranulation, VEGF signaling in endothelial cells, recruitment of leukocytes to endothelial cells, and endosomal sorting during melanogenesis.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~11kDa

Notes: For research use only, not for use in diagnostic procedure.