Product Description

CD69 Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0222-500, NCP0222-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: CD69, also known as Leu-23, is a type II transmembrane glycoprotein that is expressed on the surface of T cells, B cells, and NK cells. This phosphorylated disμlfide-linked 28 to 32-kDa homodimer is constitutively expressed on a subset of thymocytes and platelets. It also acts as an activation antigen of lymphocytes, NK cells, neutrophils, and eosinophils. Studies have shown that stimμlation of the T cell receptor (TCR) increases the expression of CD69 on the cell surface. The ability to detect the level of CD69 expression after TCR activation makes CD69 an ideal indicator of T cell activation. The FN50 antibody is widely used as a marker for T cell activation.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~17kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: Q07108

Tag: His-tag

Amino Acid Sequence: AGCGTTGGTCAGTATAATTGTCCGGGTCAGTATACCTTCAGCATGCCGAGTGATAGCCATGTGAGTAGTTGTAGTGAAGATTGGGTGGGTTATCAGCGCAAATGCTACTTCATTAGCACCGTGAAACGCAGCTGGACCAGTGCACAGAATGCCTGCAGTGAACATGGCGCCACCCTGGCAGTGATTGATAGCGAAAAAGATATGAACTTCCTGAAACGTTATGCCGGTCGCGAAGAACATTGGGTTGGTCTGAAAAAAGAACCGGGTCATCCGTGGAAATGGAGTAATGGCAAAGAATTCAATAACTGGTTCAATGTTACCGGCAGTGATAAATGCGTGTTCCTGAAAAATACCGAAGTGAGTAGTATGGAATGTGAAAAAAATCTGTACTGGATCTGTAATAAGCCGTATAAA

Expression Vector: pet-22b(+)

Research Use Only